Incidental Mutation 'R8341:Lyn'
ID644881
Institutional Source Beutler Lab
Gene Symbol Lyn
Ensembl Gene ENSMUSG00000042228
Gene NameLYN proto-oncogene, Src family tyrosine kinase
SynonymsHck-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8341 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location3678115-3813122 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 3743304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000041377] [ENSMUST00000103010] [ENSMUST00000103010]
PDB Structure Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION]
Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000041377
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041377
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103010
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103010
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik A T X: 89,754,716 K718M probably damaging Het
Abca8b T A 11: 109,955,050 I915F probably damaging Het
Adam11 C A 11: 102,776,536 H641N probably damaging Het
Amfr A G 8: 93,999,178 S192P probably damaging Het
Ano9 T A 7: 141,102,334 N676I possibly damaging Het
Arfgef1 C T 1: 10,154,328 V1428I probably benign Het
B3gnt9 C T 8: 105,253,865 R297H probably benign Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
C1s1 C T 6: 124,531,156 A625T probably damaging Het
Camkmt T C 17: 85,439,580 L251P probably damaging Het
Ceacam15 C A 7: 16,672,003 V208F probably benign Het
Clp1 T C 2: 84,723,773 K351E probably damaging Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Cubn C A 2: 13,428,724 G1125V probably damaging Het
Dpp4 C T 2: 62,347,890 V633I probably benign Het
Eif2ak1 A T 5: 143,884,937 D357V probably benign Het
Fez1 T C 9: 36,876,309 M370T possibly damaging Het
Frk G A 10: 34,586,283 E257K probably damaging Het
Gm7579 T A 7: 142,212,119 C87* probably null Het
Henmt1 T C 3: 108,958,592 V211A probably damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ints9 T A 14: 65,036,414 V556E probably benign Het
Klhl41 T C 2: 69,670,524 S110P probably benign Het
Klrk1 T C 6: 129,622,700 probably benign Het
Kmt2e A T 5: 23,499,453 S1215C probably damaging Het
Map2k5 T A 9: 63,339,098 N116Y probably damaging Het
Map3k13 G T 16: 21,921,584 E554* probably null Het
Map6 A G 7: 99,268,440 E140G possibly damaging Het
Mpv17 A C 5: 31,154,103 probably null Het
Myo1c C T 11: 75,671,427 P883S probably benign Het
Myo7b T C 18: 31,983,926 M914V probably benign Het
Olfm2 C T 9: 20,672,622 probably null Het
Olfr124 G A 17: 37,805,652 C169Y probably damaging Het
Osbpl7 T G 11: 97,060,163 L612R probably damaging Het
Polq A T 16: 37,071,771 M2012L possibly damaging Het
Ppp1r7 G A 1: 93,346,278 D59N probably benign Het
Ptbp1 A C 10: 79,863,211 E534D probably benign Het
Qser1 A G 2: 104,789,475 Y241H probably damaging Het
Rbx1 T C 15: 81,473,877 L88P probably damaging Het
Rft1 T C 14: 30,689,881 L462P probably damaging Het
Serpinb9f T A 13: 33,327,307 L77* probably null Het
Shisa9 T C 16: 11,997,151 M221T possibly damaging Het
Slc12a2 T G 18: 57,879,209 F135V possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc44a2 T C 9: 21,342,199 F88L probably benign Het
Snx21 A G 2: 164,791,885 E197G probably damaging Het
Srarp T C 4: 141,433,396 D42G possibly damaging Het
Ssfa2 A T 2: 79,657,718 K715I probably damaging Het
St6galnac1 T A 11: 116,768,888 M200L probably benign Het
Stambpl1 A T 19: 34,234,001 Q154L probably benign Het
Szt2 G T 4: 118,392,836 R492S possibly damaging Het
Thbs3 G A 3: 89,225,391 R880Q probably benign Het
Tnks A T 8: 34,873,045 L473H probably damaging Het
Ttc4 A G 4: 106,665,696 S342P probably benign Het
Uckl1 T A 2: 181,569,719 M463L probably benign Het
Unc80 T C 1: 66,649,033 S2397P possibly damaging Het
Vmn2r73 T A 7: 85,857,920 H728L probably benign Het
Vsig10l T C 7: 43,463,954 V110A probably damaging Het
Zgrf1 T A 3: 127,560,915 L61* probably null Het
Zswim5 A G 4: 116,986,792 Y1009C probably damaging Het
Other mutations in Lyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3743286 missense probably benign
IGL02744:Lyn APN 4 3738808 missense probably benign 0.00
IGL02860:Lyn APN 4 3745594 missense possibly damaging 0.77
IGL03328:Lyn APN 4 3745327 missense probably benign 0.01
IGL03370:Lyn APN 4 3780931 missense possibly damaging 0.81
Cress UTSW 4 3789908 nonsense probably null
Friede UTSW 4 3789834 nonsense probably null
Kohlrabi UTSW 4 3783089 missense possibly damaging 0.74
lechuga UTSW 4 3783050 missense probably damaging 1.00
Lemon UTSW 4 3746768 missense probably damaging 1.00
Pacific UTSW 4 3745330 missense probably damaging 1.00
R1615_Lyn_036 UTSW 4 3748765 missense probably benign 0.11
water UTSW 4 3748787 missense possibly damaging 0.93
R0079:Lyn UTSW 4 3746768 missense probably damaging 1.00
R0089:Lyn UTSW 4 3748768 missense probably benign 0.23
R0582:Lyn UTSW 4 3743296 missense probably damaging 1.00
R0747:Lyn UTSW 4 3745638 splice site probably benign
R1460:Lyn UTSW 4 3789908 nonsense probably null
R1615:Lyn UTSW 4 3748765 missense probably benign 0.11
R1654:Lyn UTSW 4 3789912 missense probably damaging 0.99
R1703:Lyn UTSW 4 3738867 splice site probably null
R2301:Lyn UTSW 4 3780959 missense probably damaging 1.00
R2421:Lyn UTSW 4 3748787 missense possibly damaging 0.93
R2512:Lyn UTSW 4 3745542 missense probably benign 0.01
R3418:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3419:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3701:Lyn UTSW 4 3742455 missense probably benign
R3702:Lyn UTSW 4 3742455 missense probably benign
R3736:Lyn UTSW 4 3745330 missense probably damaging 1.00
R4350:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4351:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4352:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4649:Lyn UTSW 4 3738850 missense probably benign
R5738:Lyn UTSW 4 3782987 missense probably damaging 1.00
R5875:Lyn UTSW 4 3745631 splice site probably null
R6375:Lyn UTSW 4 3745527 missense probably damaging 1.00
R7029:Lyn UTSW 4 3782996 missense probably damaging 0.98
R7621:Lyn UTSW 4 3789834 nonsense probably null
R7726:Lyn UTSW 4 3756428 nonsense probably null
R7940:Lyn UTSW 4 3783089 missense possibly damaging 0.74
R8169:Lyn UTSW 4 3783050 missense probably damaging 1.00
R8782:Lyn UTSW 4 3783055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTACAGGTGGGAAGCACAG -3'
(R):5'- ACGTCTTAAGTAGCATTTTGGC -3'

Sequencing Primer
(F):5'- GAGCTTCACTCCATGGCC -3'
(R):5'- TTTTGGCAAAGAAAGAAACAGTGCC -3'
Posted On2020-09-02