Incidental Mutation 'R8341:Vsig10l'
ID 644892
Institutional Source Beutler Lab
Gene Symbol Vsig10l
Ensembl Gene ENSMUSG00000070604
Gene Name V-set and immunoglobulin domain containing 10 like
Synonyms 2210412E05Rik
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.204) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43112575-43121443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43113378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000144692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107977] [ENSMUST00000203042] [ENSMUST00000203633] [ENSMUST00000203769] [ENSMUST00000204680]
AlphaFold D3YZF7
Predicted Effect probably benign
Transcript: ENSMUST00000107977
AA Change: V212A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103611
Gene: ENSMUSG00000070604
AA Change: V212A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
IG 183 285 1.92e0 SMART
IG 298 383 2.15e-3 SMART
IGc2 406 465 4.19e-6 SMART
Blast:IG_like 582 649 1e-13 BLAST
transmembrane domain 764 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203042
Predicted Effect probably benign
Transcript: ENSMUST00000203633
SMART Domains Protein: ENSMUSP00000145061
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 216 2.7e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203769
AA Change: V110A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144692
Gene: ENSMUSG00000070604
AA Change: V110A

DomainStartEndE-ValueType
IG 81 183 8.1e-3 SMART
IG 196 281 9.2e-6 SMART
IGc2 304 363 1.8e-8 SMART
Blast:IG_like 480 547 9e-14 BLAST
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204680
SMART Domains Protein: ENSMUSP00000145493
Gene: ENSMUSG00000107482

DomainStartEndE-ValueType
ETF 26 168 2.4e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Vsig10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Vsig10l APN 7 43,114,678 (GRCm39) missense probably damaging 1.00
IGL01390:Vsig10l APN 7 43,115,889 (GRCm39) missense probably damaging 0.97
IGL02401:Vsig10l APN 7 43,113,468 (GRCm39) missense probably damaging 1.00
IGL02404:Vsig10l APN 7 43,113,171 (GRCm39) missense possibly damaging 0.85
IGL02514:Vsig10l APN 7 43,113,338 (GRCm39) missense probably benign 0.02
IGL02636:Vsig10l APN 7 43,113,002 (GRCm39) missense possibly damaging 0.53
IGL02805:Vsig10l APN 7 43,114,666 (GRCm39) missense probably damaging 1.00
IGL02823:Vsig10l APN 7 43,115,888 (GRCm39) missense probably damaging 1.00
IGL02827:Vsig10l APN 7 43,114,293 (GRCm39) missense probably damaging 1.00
R0111:Vsig10l UTSW 7 43,117,525 (GRCm39) missense probably damaging 0.97
R0394:Vsig10l UTSW 7 43,114,879 (GRCm39) missense probably damaging 0.97
R0465:Vsig10l UTSW 7 43,116,866 (GRCm39) missense probably damaging 1.00
R0632:Vsig10l UTSW 7 43,113,561 (GRCm39) missense probably damaging 0.97
R1689:Vsig10l UTSW 7 43,114,792 (GRCm39) missense possibly damaging 0.93
R1991:Vsig10l UTSW 7 43,116,892 (GRCm39) missense possibly damaging 0.89
R2103:Vsig10l UTSW 7 43,116,892 (GRCm39) missense possibly damaging 0.89
R2358:Vsig10l UTSW 7 43,118,185 (GRCm39) missense probably benign 0.00
R3015:Vsig10l UTSW 7 43,116,881 (GRCm39) missense possibly damaging 0.73
R4024:Vsig10l UTSW 7 43,117,510 (GRCm39) missense probably benign 0.33
R4031:Vsig10l UTSW 7 43,114,798 (GRCm39) missense probably damaging 1.00
R4807:Vsig10l UTSW 7 43,113,173 (GRCm39) missense possibly damaging 0.53
R5020:Vsig10l UTSW 7 43,114,741 (GRCm39) nonsense probably null
R5261:Vsig10l UTSW 7 43,120,274 (GRCm39) missense probably damaging 1.00
R5317:Vsig10l UTSW 7 43,114,247 (GRCm39) missense probably damaging 1.00
R5426:Vsig10l UTSW 7 43,114,247 (GRCm39) missense probably damaging 0.97
R5656:Vsig10l UTSW 7 43,113,575 (GRCm39) nonsense probably null
R5842:Vsig10l UTSW 7 43,118,396 (GRCm39) missense probably benign 0.15
R6012:Vsig10l UTSW 7 43,117,439 (GRCm39) missense probably damaging 1.00
R6235:Vsig10l UTSW 7 43,118,396 (GRCm39) missense probably benign 0.15
R6309:Vsig10l UTSW 7 43,120,397 (GRCm39) splice site probably null
R6994:Vsig10l UTSW 7 43,114,491 (GRCm39) missense possibly damaging 0.71
R7250:Vsig10l UTSW 7 43,113,099 (GRCm39) missense probably benign
R7397:Vsig10l UTSW 7 43,117,431 (GRCm39) missense probably damaging 1.00
R7767:Vsig10l UTSW 7 43,113,141 (GRCm39) missense probably damaging 0.96
R7956:Vsig10l UTSW 7 43,117,494 (GRCm39) missense probably benign
R8086:Vsig10l UTSW 7 43,114,876 (GRCm39) missense possibly damaging 0.92
R8139:Vsig10l UTSW 7 43,113,153 (GRCm39) missense probably benign 0.00
R8297:Vsig10l UTSW 7 43,113,531 (GRCm39) missense possibly damaging 0.50
R8519:Vsig10l UTSW 7 43,114,326 (GRCm39) missense probably benign 0.33
R8925:Vsig10l UTSW 7 43,116,020 (GRCm39) missense probably benign 0.41
R8927:Vsig10l UTSW 7 43,116,020 (GRCm39) missense probably benign 0.41
R8948:Vsig10l UTSW 7 43,117,623 (GRCm39) missense possibly damaging 0.53
R9157:Vsig10l UTSW 7 43,112,948 (GRCm39) missense
R9203:Vsig10l UTSW 7 43,112,657 (GRCm39) start codon destroyed probably null
R9481:Vsig10l UTSW 7 43,112,795 (GRCm39) nonsense probably null
X0028:Vsig10l UTSW 7 43,112,788 (GRCm39) utr 3 prime probably benign
X0067:Vsig10l UTSW 7 43,116,914 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGCCTCAGGTTCAAAG -3'
(R):5'- ACAAACTCTCGAATCTGCTGG -3'

Sequencing Primer
(F):5'- TCAGGTTCAAAGCTATCCCTGGAG -3'
(R):5'- AACTCTCGAATCTGCTGGGAGAC -3'
Posted On 2020-09-02