Incidental Mutation 'R8341:Ptbp1'
ID 644904
Institutional Source Beutler Lab
Gene Symbol Ptbp1
Ensembl Gene ENSMUSG00000006498
Gene Name polypyrimidine tract binding protein 1
Synonyms Ptb, hnRNP I
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 79690502-79700269 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 79699045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 534 (E534D)
Ref Sequence ENSEMBL: ENSMUSP00000126192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000092325] [ENSMUST00000095457] [ENSMUST00000165601] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000172282] [ENSMUST00000166023] [ENSMUST00000167250] [ENSMUST00000167707] [ENSMUST00000167897] [ENSMUST00000168683] [ENSMUST00000169483] [ENSMUST00000171599]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000057343
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092325
SMART Domains Protein: ENSMUSP00000089979
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
coiled coil region 430 460 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
AA Change: E468D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498
AA Change: E468D

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165601
SMART Domains Protein: ENSMUSP00000128681
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 266 7.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165704
AA Change: E508D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498
AA Change: E508D

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172282
AA Change: E534D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498
AA Change: E534D

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166023
SMART Domains Protein: ENSMUSP00000127171
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167250
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167707
SMART Domains Protein: ENSMUSP00000132994
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Blast:acidPPc 125 159 8e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167897
SMART Domains Protein: ENSMUSP00000127972
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168683
SMART Domains Protein: ENSMUSP00000132383
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
SCOP:d2u1a__ 17 55 3e-3 SMART
PDB:2AD9|A 18 55 9e-19 PDB
Blast:RRM 29 55 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169091
SMART Domains Protein: ENSMUSP00000128449
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 13 19 N/A INTRINSIC
Pfam:RRM_5 29 81 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169483
SMART Domains Protein: ENSMUSP00000127507
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171599
SMART Domains Protein: ENSMUSP00000131296
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 87 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA-binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has four repeats of quasi-RNA recognition motif (RRM) domains that bind RNAs. This protein binds to the intronic polypyrimidine tracts that requires pre-mRNA splicing and acts via the protein degradation ubiquitin-proteasome pathway. It may also promote the binding of U2 snRNP to pre-mRNAs. This protein is localized in the nucleoplasm and it is also detected in the perinucleolar structure. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die before E6.5. Mice homozygous for a conditional allele activated in neuronal stem cells (NSCs) exhibit premature death, and non-obstructive hydrocephaly with loss of ependymal cells due to precocious NSC differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Ptbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Ptbp1 APN 10 79,695,796 (GRCm39) splice site probably benign
IGL01335:Ptbp1 APN 10 79,698,708 (GRCm39) splice site probably null
IGL03119:Ptbp1 APN 10 79,695,458 (GRCm39) missense probably damaging 1.00
carillon UTSW 10 79,694,897 (GRCm39) missense probably damaging 0.98
Citi UTSW 10 79,695,766 (GRCm39) missense probably benign 0.31
R1433:Ptbp1 UTSW 10 79,699,107 (GRCm39) missense probably damaging 1.00
R2418:Ptbp1 UTSW 10 79,695,511 (GRCm39) missense probably damaging 0.98
R4222:Ptbp1 UTSW 10 79,695,047 (GRCm39) missense probably benign 0.07
R4223:Ptbp1 UTSW 10 79,695,047 (GRCm39) missense probably benign 0.07
R4224:Ptbp1 UTSW 10 79,695,047 (GRCm39) missense probably benign 0.07
R4688:Ptbp1 UTSW 10 79,692,342 (GRCm39) missense possibly damaging 0.87
R5841:Ptbp1 UTSW 10 79,695,766 (GRCm39) missense probably benign 0.31
R6961:Ptbp1 UTSW 10 79,695,111 (GRCm39) splice site probably null
R7242:Ptbp1 UTSW 10 79,692,222 (GRCm39) missense unknown
R7579:Ptbp1 UTSW 10 79,694,954 (GRCm39) missense probably benign 0.02
R8832:Ptbp1 UTSW 10 79,699,023 (GRCm39) missense probably damaging 1.00
R9141:Ptbp1 UTSW 10 79,694,897 (GRCm39) missense probably damaging 0.98
R9426:Ptbp1 UTSW 10 79,694,897 (GRCm39) missense probably damaging 0.98
R9465:Ptbp1 UTSW 10 79,695,615 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GGCTTCAAGTTCTTCCAGTGAG -3'
(R):5'- AAGCCATTTCCTGCCACTGC -3'

Sequencing Primer
(F):5'- TTCCAGTGAGTAAAGCCCTG -3'
(R):5'- CACTGCAGAGTGGGCTAG -3'
Posted On 2020-09-02