Incidental Mutation 'R8341:Myo1c'
ID 644905
Institutional Source Beutler Lab
Gene Symbol Myo1c
Ensembl Gene ENSMUSG00000017774
Gene Name myosin IC
Synonyms myr2, mm1beta, C80397, myosin-Ibeta
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.684) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 75541330-75564736 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 75562253 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 883 (P883S)
Ref Sequence ENSEMBL: ENSMUSP00000070388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069057] [ENSMUST00000102504] [ENSMUST00000102505] [ENSMUST00000108431]
AlphaFold Q9WTI7
PDB Structure Crystal Structure of Myosin-1c tail in complex with Calmodulin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000069057
AA Change: P883S

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070388
Gene: ENSMUSG00000017774
AA Change: P883S

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102504
AA Change: P883S

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099562
Gene: ENSMUSG00000017774
AA Change: P883S

DomainStartEndE-ValueType
MYSc 5 697 N/A SMART
IQ 698 720 3.85e-3 SMART
IQ 721 743 2.09e-4 SMART
Blast:MYSc 751 780 5e-9 BLAST
low complexity region 804 815 N/A INTRINSIC
Pfam:Myosin_TH1 838 1024 1.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102505
AA Change: P918S

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099563
Gene: ENSMUSG00000017774
AA Change: P918S

DomainStartEndE-ValueType
MYSc 40 732 N/A SMART
IQ 733 755 3.85e-3 SMART
IQ 756 778 2.09e-4 SMART
Blast:MYSc 786 815 6e-9 BLAST
low complexity region 839 850 N/A INTRINSIC
Pfam:Myosin_TH1 874 1052 2.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108431
AA Change: P899S

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104069
Gene: ENSMUSG00000017774
AA Change: P899S

DomainStartEndE-ValueType
MYSc 21 713 N/A SMART
IQ 714 736 3.85e-3 SMART
IQ 737 759 2.09e-4 SMART
Blast:MYSc 767 796 5e-9 BLAST
low complexity region 820 831 N/A INTRINSIC
Pfam:Myosin_TH1 854 1040 3.3e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the unconventional myosin protein family, which are actin-based molecular motors. The protein is found in the cytoplasm, and one isoform with a unique N-terminus is also found in the nucleus. The protein functions in intracellular vesicle transport to the plasma membrane. The nuclear isoform associates with RNA polymerase I and II and functions in transcription initiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in (Y61G) mutation that sensitizes to N6-modified ADP analogs display altered fast adaption in vestibular hair cells. Mice homozygous for a nuclear isoform-specifc knock-out allele exhibit minor changes in bone marrow density and red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Myo1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Myo1c APN 11 75,563,076 (GRCm39) missense probably damaging 1.00
IGL02054:Myo1c APN 11 75,551,962 (GRCm39) missense probably benign 0.30
IGL02115:Myo1c APN 11 75,552,417 (GRCm39) missense probably damaging 0.99
IGL02375:Myo1c APN 11 75,552,400 (GRCm39) missense probably benign 0.00
IGL02878:Myo1c APN 11 75,559,859 (GRCm39) missense possibly damaging 0.93
IGL03008:Myo1c APN 11 75,549,240 (GRCm39) missense probably benign 0.13
Sweeper UTSW 11 75,560,856 (GRCm39) nonsense probably null
R0070:Myo1c UTSW 11 75,551,076 (GRCm39) missense probably benign 0.39
R0070:Myo1c UTSW 11 75,551,076 (GRCm39) missense probably benign 0.39
R0138:Myo1c UTSW 11 75,551,827 (GRCm39) missense possibly damaging 0.92
R0200:Myo1c UTSW 11 75,563,008 (GRCm39) missense probably benign 0.00
R0227:Myo1c UTSW 11 75,549,520 (GRCm39) missense probably benign 0.34
R0257:Myo1c UTSW 11 75,556,342 (GRCm39) critical splice acceptor site probably null
R0513:Myo1c UTSW 11 75,556,657 (GRCm39) splice site probably null
R0587:Myo1c UTSW 11 75,548,616 (GRCm39) missense probably damaging 1.00
R0667:Myo1c UTSW 11 75,559,338 (GRCm39) missense probably damaging 1.00
R1469:Myo1c UTSW 11 75,560,787 (GRCm39) missense probably damaging 1.00
R1469:Myo1c UTSW 11 75,560,787 (GRCm39) missense probably damaging 1.00
R1793:Myo1c UTSW 11 75,548,415 (GRCm39) missense probably damaging 0.98
R1922:Myo1c UTSW 11 75,559,055 (GRCm39) missense probably benign
R2000:Myo1c UTSW 11 75,561,405 (GRCm39) missense probably damaging 1.00
R3983:Myo1c UTSW 11 75,552,325 (GRCm39) missense probably benign 0.05
R4583:Myo1c UTSW 11 75,562,688 (GRCm39) missense possibly damaging 0.72
R4599:Myo1c UTSW 11 75,559,019 (GRCm39) missense probably damaging 0.99
R4671:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4682:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4708:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4709:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4742:Myo1c UTSW 11 75,560,856 (GRCm39) nonsense probably null
R4770:Myo1c UTSW 11 75,551,139 (GRCm39) nonsense probably null
R4888:Myo1c UTSW 11 75,560,053 (GRCm39) missense probably damaging 1.00
R4915:Myo1c UTSW 11 75,547,135 (GRCm39) start codon destroyed probably null
R4934:Myo1c UTSW 11 75,562,676 (GRCm39) missense probably damaging 1.00
R4971:Myo1c UTSW 11 75,562,414 (GRCm39) missense probably damaging 1.00
R5319:Myo1c UTSW 11 75,552,852 (GRCm39) missense possibly damaging 0.95
R5589:Myo1c UTSW 11 75,548,414 (GRCm39) missense possibly damaging 0.74
R5624:Myo1c UTSW 11 75,553,461 (GRCm39) missense probably damaging 0.99
R5756:Myo1c UTSW 11 75,549,240 (GRCm39) missense probably benign 0.42
R5959:Myo1c UTSW 11 75,548,345 (GRCm39) missense probably benign 0.37
R6160:Myo1c UTSW 11 75,541,568 (GRCm39) missense probably benign 0.00
R6559:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6568:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6569:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6574:Myo1c UTSW 11 75,547,124 (GRCm39) start gained probably benign
R6579:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6580:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6583:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6640:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6642:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6643:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6679:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6680:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6687:Myo1c UTSW 11 75,563,027 (GRCm39) missense probably benign
R6695:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6696:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6700:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6712:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6713:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R6715:Myo1c UTSW 11 75,562,461 (GRCm39) missense probably benign 0.42
R7081:Myo1c UTSW 11 75,551,789 (GRCm39) missense probably benign
R7265:Myo1c UTSW 11 75,560,616 (GRCm39) missense possibly damaging 0.89
R7397:Myo1c UTSW 11 75,562,068 (GRCm39) missense probably benign 0.17
R7586:Myo1c UTSW 11 75,548,345 (GRCm39) missense possibly damaging 0.77
R7714:Myo1c UTSW 11 75,549,519 (GRCm39) missense probably damaging 1.00
R8260:Myo1c UTSW 11 75,546,942 (GRCm39) unclassified probably benign
R8466:Myo1c UTSW 11 75,549,213 (GRCm39) missense probably damaging 1.00
R8771:Myo1c UTSW 11 75,556,709 (GRCm39) missense probably benign
R8829:Myo1c UTSW 11 75,561,072 (GRCm39) missense probably benign 0.03
R8832:Myo1c UTSW 11 75,561,072 (GRCm39) missense probably benign 0.03
R9243:Myo1c UTSW 11 75,541,437 (GRCm39) unclassified probably benign
R9489:Myo1c UTSW 11 75,559,899 (GRCm39) missense probably benign 0.00
R9605:Myo1c UTSW 11 75,559,899 (GRCm39) missense probably benign 0.00
R9744:Myo1c UTSW 11 75,562,797 (GRCm39) missense probably damaging 1.00
R9782:Myo1c UTSW 11 75,549,273 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCTAGTGAAATTTTCAAGGGC -3'
(R):5'- GTATTTTACCACGGGCACGG -3'

Sequencing Primer
(F):5'- TTTTCAAGGGCAAGAAGGACAACTAC -3'
(R):5'- TTACCACGGGCACGGCATAC -3'
Posted On 2020-09-02