Mutagenetix > Incidental Mutation

Incidental Mutation 'R8341:Abca8b'

644908

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8341 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109955050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 915 (I915F)

Ref Sequence

ENSEMBL: ENSMUSP00000020948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

AlphaFold

Q8K440

Predicted Effect

probably damaging
Transcript: ENSMUST00000020948
AA Change: I915F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: I915F

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106669
AA Change: I853F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: I853F

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932429P05Rik	A	T	X: 89,754,716	K718M	probably damaging	Het
Adam11	C	A	11: 102,776,536	H641N	probably damaging	Het
Amfr	A	G	8: 93,999,178	S192P	probably damaging	Het
Ano9	T	A	7: 141,102,334	N676I	possibly damaging	Het
Arfgef1	C	T	1: 10,154,328	V1428I	probably benign	Het
B3gnt9	C	T	8: 105,253,865	R297H	probably benign	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
C1s1	C	T	6: 124,531,156	A625T	probably damaging	Het
Camkmt	T	C	17: 85,439,580	L251P	probably damaging	Het
Ceacam15	C	A	7: 16,672,003	V208F	probably benign	Het
Clp1	T	C	2: 84,723,773	K351E	probably damaging	Het
Csmd3	T	C	15: 47,698,151	Y1343C		Het
Cubn	C	A	2: 13,428,724	G1125V	probably damaging	Het
Dpp4	C	T	2: 62,347,890	V633I	probably benign	Het
Eif2ak1	A	T	5: 143,884,937	D357V	probably benign	Het
Fez1	T	C	9: 36,876,309	M370T	possibly damaging	Het
Frk	G	A	10: 34,586,283	E257K	probably damaging	Het
Gm7579	T	A	7: 142,212,119	C87*	probably null	Het
Henmt1	T	C	3: 108,958,592	V211A	probably damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ints9	T	A	14: 65,036,414	V556E	probably benign	Het
Klhl41	T	C	2: 69,670,524	S110P	probably benign	Het
Klrk1	T	C	6: 129,622,700		probably benign	Het
Kmt2e	A	T	5: 23,499,453	S1215C	probably damaging	Het
Lyn	T	C	4: 3,743,304		probably null	Het
Map2k5	T	A	9: 63,339,098	N116Y	probably damaging	Het
Map3k13	G	T	16: 21,921,584	E554*	probably null	Het
Map6	A	G	7: 99,268,440	E140G	possibly damaging	Het
Mpv17	A	C	5: 31,154,103		probably null	Het
Myo1c	C	T	11: 75,671,427	P883S	probably benign	Het
Myo7b	T	C	18: 31,983,926	M914V	probably benign	Het
Olfm2	C	T	9: 20,672,622		probably null	Het
Olfr124	G	A	17: 37,805,652	C169Y	probably damaging	Het
Osbpl7	T	G	11: 97,060,163	L612R	probably damaging	Het
Polq	A	T	16: 37,071,771	M2012L	possibly damaging	Het
Ppp1r7	G	A	1: 93,346,278	D59N	probably benign	Het
Ptbp1	A	C	10: 79,863,211	E534D	probably benign	Het
Qser1	A	G	2: 104,789,475	Y241H	probably damaging	Het
Rbx1	T	C	15: 81,473,877	L88P	probably damaging	Het
Rft1	T	C	14: 30,689,881	L462P	probably damaging	Het
Serpinb9f	T	A	13: 33,327,307	L77*	probably null	Het
Shisa9	T	C	16: 11,997,151	M221T	possibly damaging	Het
Slc12a2	T	G	18: 57,879,209	F135V	possibly damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc44a2	T	C	9: 21,342,199	F88L	probably benign	Het
Snx21	A	G	2: 164,791,885	E197G	probably damaging	Het
Srarp	T	C	4: 141,433,396	D42G	possibly damaging	Het
Ssfa2	A	T	2: 79,657,718	K715I	probably damaging	Het
St6galnac1	T	A	11: 116,768,888	M200L	probably benign	Het
Stambpl1	A	T	19: 34,234,001	Q154L	probably benign	Het
Szt2	G	T	4: 118,392,836	R492S	possibly damaging	Het
Thbs3	G	A	3: 89,225,391	R880Q	probably benign	Het
Tnks	A	T	8: 34,873,045	L473H	probably damaging	Het
Ttc4	A	G	4: 106,665,696	S342P	probably benign	Het
Uckl1	T	A	2: 181,569,719	M463L	probably benign	Het
Unc80	T	C	1: 66,649,033	S2397P	possibly damaging	Het
Vmn2r73	T	A	7: 85,857,920	H728L	probably benign	Het
Vsig10l	T	C	7: 43,463,954	V110A	probably damaging	Het
Zgrf1	T	A	3: 127,560,915	L61*	probably null	Het
Zswim5	A	G	4: 116,986,792	Y1009C	probably damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7658:Abca8b	UTSW	11	109935717	missense	probably benign	0.00
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
R8924:Abca8b	UTSW	11	109947177	missense	probably benign	0.00
R9002:Abca8b	UTSW	11	109952630	missense	probably benign	0.02
R9032:Abca8b	UTSW	11	109957247	missense	probably benign	0.04
R9099:Abca8b	UTSW	11	109980882	missense	probably damaging	1.00
R9124:Abca8b	UTSW	11	109937767	missense	probably damaging	0.97
R9178:Abca8b	UTSW	11	109950111	missense	probably benign	0.00
R9188:Abca8b	UTSW	11	109981735	nonsense	probably null
R9277:Abca8b	UTSW	11	109976521	missense	probably damaging	0.99
R9340:Abca8b	UTSW	11	109950113	missense	probably benign	0.43
R9371:Abca8b	UTSW	11	109967672	missense	probably damaging	1.00
R9382:Abca8b	UTSW	11	109979885	missense	probably benign
R9450:Abca8b	UTSW	11	109969104	missense	probably damaging	0.98
R9462:Abca8b	UTSW	11	109953607	missense
R9712:Abca8b	UTSW	11	109942337	missense	probably benign	0.30
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- AAATCAGGAGTGGGAATCATCC -3'
(R):5'- TGACAGCTTTTATTCTCTGCAGGC -3'

Sequencing Primer
(F):5'- TTTGAACACATACGTCGCGAG -3'
(R):5'- CTCTTGATACTGGTAGTCGGCATC -3'

Posted On

2020-09-02