Incidental Mutation 'R8341:Ints9'
ID 644912
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 64950045-65039832 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65036414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 556 (V556E)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
AlphaFold Q8K114
Predicted Effect probably benign
Transcript: ENSMUST00000043914
AA Change: V556E

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: V556E

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik A T X: 89,754,716 K718M probably damaging Het
Abca8b T A 11: 109,955,050 I915F probably damaging Het
Adam11 C A 11: 102,776,536 H641N probably damaging Het
Amfr A G 8: 93,999,178 S192P probably damaging Het
Ano9 T A 7: 141,102,334 N676I possibly damaging Het
Arfgef1 C T 1: 10,154,328 V1428I probably benign Het
B3gnt9 C T 8: 105,253,865 R297H probably benign Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
C1s1 C T 6: 124,531,156 A625T probably damaging Het
Camkmt T C 17: 85,439,580 L251P probably damaging Het
Ceacam15 C A 7: 16,672,003 V208F probably benign Het
Clp1 T C 2: 84,723,773 K351E probably damaging Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Cubn C A 2: 13,428,724 G1125V probably damaging Het
Dpp4 C T 2: 62,347,890 V633I probably benign Het
Eif2ak1 A T 5: 143,884,937 D357V probably benign Het
Fez1 T C 9: 36,876,309 M370T possibly damaging Het
Frk G A 10: 34,586,283 E257K probably damaging Het
Gm7579 T A 7: 142,212,119 C87* probably null Het
Henmt1 T C 3: 108,958,592 V211A probably damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Klhl41 T C 2: 69,670,524 S110P probably benign Het
Klrk1 T C 6: 129,622,700 probably benign Het
Kmt2e A T 5: 23,499,453 S1215C probably damaging Het
Lyn T C 4: 3,743,304 probably null Het
Map2k5 T A 9: 63,339,098 N116Y probably damaging Het
Map3k13 G T 16: 21,921,584 E554* probably null Het
Map6 A G 7: 99,268,440 E140G possibly damaging Het
Mpv17 A C 5: 31,154,103 probably null Het
Myo1c C T 11: 75,671,427 P883S probably benign Het
Myo7b T C 18: 31,983,926 M914V probably benign Het
Olfm2 C T 9: 20,672,622 probably null Het
Olfr124 G A 17: 37,805,652 C169Y probably damaging Het
Osbpl7 T G 11: 97,060,163 L612R probably damaging Het
Polq A T 16: 37,071,771 M2012L possibly damaging Het
Ppp1r7 G A 1: 93,346,278 D59N probably benign Het
Ptbp1 A C 10: 79,863,211 E534D probably benign Het
Qser1 A G 2: 104,789,475 Y241H probably damaging Het
Rbx1 T C 15: 81,473,877 L88P probably damaging Het
Rft1 T C 14: 30,689,881 L462P probably damaging Het
Serpinb9f T A 13: 33,327,307 L77* probably null Het
Shisa9 T C 16: 11,997,151 M221T possibly damaging Het
Slc12a2 T G 18: 57,879,209 F135V possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc44a2 T C 9: 21,342,199 F88L probably benign Het
Snx21 A G 2: 164,791,885 E197G probably damaging Het
Srarp T C 4: 141,433,396 D42G possibly damaging Het
Ssfa2 A T 2: 79,657,718 K715I probably damaging Het
St6galnac1 T A 11: 116,768,888 M200L probably benign Het
Stambpl1 A T 19: 34,234,001 Q154L probably benign Het
Szt2 G T 4: 118,392,836 R492S possibly damaging Het
Thbs3 G A 3: 89,225,391 R880Q probably benign Het
Tnks A T 8: 34,873,045 L473H probably damaging Het
Ttc4 A G 4: 106,665,696 S342P probably benign Het
Uckl1 T A 2: 181,569,719 M463L probably benign Het
Unc80 T C 1: 66,649,033 S2397P possibly damaging Het
Vmn2r73 T A 7: 85,857,920 H728L probably benign Het
Vsig10l T C 7: 43,463,954 V110A probably damaging Het
Zgrf1 T A 3: 127,560,915 L61* probably null Het
Zswim5 A G 4: 116,986,792 Y1009C probably damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1525:Ints9 UTSW 14 64995011 missense probably benign 0.05
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R3015:Ints9 UTSW 14 64950278 missense probably benign 0.00
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6241:Ints9 UTSW 14 64980210 missense possibly damaging 0.90
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
R7422:Ints9 UTSW 14 65032298 missense possibly damaging 0.93
R7442:Ints9 UTSW 14 64995064 nonsense probably null
R7475:Ints9 UTSW 14 65026465 missense probably null 0.23
R8183:Ints9 UTSW 14 65036453 missense probably damaging 0.98
R8223:Ints9 UTSW 14 65020360 missense possibly damaging 0.94
R8282:Ints9 UTSW 14 65007308 missense probably benign 0.00
R8314:Ints9 UTSW 14 65029030 missense probably damaging 1.00
R8548:Ints9 UTSW 14 65032321 missense probably benign 0.39
R9356:Ints9 UTSW 14 65032321 missense probably benign 0.39
R9434:Ints9 UTSW 14 65008057 missense probably benign 0.00
Z1176:Ints9 UTSW 14 65037454 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAAGAACAGTATGATGGCCG -3'
(R):5'- TGTTTCGAGTACACCCAAGTC -3'

Sequencing Primer
(F):5'- AGAACAGTATGATGGCCGTCCTTG -3'
(R):5'- CCCAAGCTTCGGTGTCTGATTG -3'
Posted On 2020-09-02