Incidental Mutation 'R8341:Ints9'
ID 644912
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Name integrator complex subunit 9
Synonyms D14Ertd231e
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 65187494-65277284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 65273863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 556 (V556E)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
AlphaFold Q8K114
Predicted Effect probably benign
Transcript: ENSMUST00000043914
AA Change: V556E

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: V556E

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65,274,870 (GRCm39) missense probably benign 0.00
IGL02374:Ints9 APN 14 65,276,782 (GRCm39) missense probably benign 0.00
IGL02728:Ints9 APN 14 65,230,457 (GRCm39) missense probably damaging 1.00
IGL02992:Ints9 APN 14 65,217,613 (GRCm39) missense probably benign 0.08
IGL03151:Ints9 APN 14 65,269,789 (GRCm39) missense possibly damaging 0.86
R0437:Ints9 UTSW 14 65,223,818 (GRCm39) splice site probably benign
R0582:Ints9 UTSW 14 65,217,598 (GRCm39) missense probably damaging 1.00
R1525:Ints9 UTSW 14 65,232,460 (GRCm39) missense probably benign 0.05
R1569:Ints9 UTSW 14 65,217,571 (GRCm39) missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65,269,705 (GRCm39) missense probably damaging 1.00
R1839:Ints9 UTSW 14 65,253,979 (GRCm39) missense probably damaging 1.00
R1862:Ints9 UTSW 14 65,263,862 (GRCm39) missense probably benign
R1892:Ints9 UTSW 14 65,257,872 (GRCm39) missense probably benign 0.08
R2146:Ints9 UTSW 14 65,223,792 (GRCm39) missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65,245,446 (GRCm39) missense possibly damaging 0.61
R3015:Ints9 UTSW 14 65,187,727 (GRCm39) missense probably benign 0.00
R4133:Ints9 UTSW 14 65,228,003 (GRCm39) missense probably benign
R4180:Ints9 UTSW 14 65,230,430 (GRCm39) missense probably damaging 1.00
R4509:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65,266,381 (GRCm39) missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65,269,729 (GRCm39) missense possibly damaging 0.82
R5023:Ints9 UTSW 14 65,217,677 (GRCm39) missense probably damaging 1.00
R5117:Ints9 UTSW 14 65,230,540 (GRCm39) nonsense probably null
R5261:Ints9 UTSW 14 65,245,521 (GRCm39) missense probably benign 0.25
R5582:Ints9 UTSW 14 65,266,345 (GRCm39) missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65,276,777 (GRCm39) missense probably damaging 1.00
R6009:Ints9 UTSW 14 65,245,531 (GRCm39) missense probably benign 0.43
R6241:Ints9 UTSW 14 65,217,659 (GRCm39) missense possibly damaging 0.90
R6351:Ints9 UTSW 14 65,230,456 (GRCm39) missense probably damaging 0.98
R6821:Ints9 UTSW 14 65,274,907 (GRCm39) missense probably benign 0.20
R7422:Ints9 UTSW 14 65,269,747 (GRCm39) missense possibly damaging 0.93
R7442:Ints9 UTSW 14 65,232,513 (GRCm39) nonsense probably null
R7475:Ints9 UTSW 14 65,263,914 (GRCm39) missense probably null 0.23
R8183:Ints9 UTSW 14 65,273,902 (GRCm39) missense probably damaging 0.98
R8223:Ints9 UTSW 14 65,257,809 (GRCm39) missense possibly damaging 0.94
R8282:Ints9 UTSW 14 65,244,757 (GRCm39) missense probably benign 0.00
R8314:Ints9 UTSW 14 65,266,479 (GRCm39) missense probably damaging 1.00
R8548:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9356:Ints9 UTSW 14 65,269,770 (GRCm39) missense probably benign 0.39
R9434:Ints9 UTSW 14 65,245,506 (GRCm39) missense probably benign 0.00
Z1176:Ints9 UTSW 14 65,274,903 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAAGAACAGTATGATGGCCG -3'
(R):5'- TGTTTCGAGTACACCCAAGTC -3'

Sequencing Primer
(F):5'- AGAACAGTATGATGGCCGTCCTTG -3'
(R):5'- CCCAAGCTTCGGTGTCTGATTG -3'
Posted On 2020-09-02