Incidental Mutation 'R8341:Shisa9'
ID644915
Institutional Source Beutler Lab
Gene Symbol Shisa9
Ensembl Gene ENSMUSG00000022494
Gene Nameshisa family member 9
SynonymsCKAMP44, 2700045P11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8341 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location11984113-12270902 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11997151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 221 (M221T)
Ref Sequence ENSEMBL: ENSMUSP00000132646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023138] [ENSMUST00000170672]
Predicted Effect probably benign
Transcript: ENSMUST00000023138
AA Change: M221T

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023138
Gene: ENSMUSG00000022494
AA Change: M221T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 70 254 7.9e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170672
AA Change: M221T

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132646
Gene: ENSMUSG00000022494
AA Change: M221T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 61 N/A INTRINSIC
Pfam:Shisa 71 260 2.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced AMPA-mediated synaptic currents in retinogeniculate and corticogeniculate synapses, enhanced paired-pulse facilitation in retinogeniculate synapses and decreased synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,955,050 I915F probably damaging Het
Adam11 C A 11: 102,776,536 H641N probably damaging Het
Amfr A G 8: 93,999,178 S192P probably damaging Het
Ano9 T A 7: 141,102,334 N676I possibly damaging Het
Arfgef1 C T 1: 10,154,328 V1428I probably benign Het
B3gnt9 C T 8: 105,253,865 R297H probably benign Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
C1s1 C T 6: 124,531,156 A625T probably damaging Het
Camkmt T C 17: 85,439,580 L251P probably damaging Het
Ceacam15 C A 7: 16,672,003 V208F probably benign Het
Clp1 T C 2: 84,723,773 K351E probably damaging Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Cubn C A 2: 13,428,724 G1125V probably damaging Het
Dpp4 C T 2: 62,347,890 V633I probably benign Het
Eif2ak1 A T 5: 143,884,937 D357V probably benign Het
Fez1 T C 9: 36,876,309 M370T possibly damaging Het
Frk G A 10: 34,586,283 E257K probably damaging Het
Gm7579 T A 7: 142,212,119 C87* probably null Het
Henmt1 T C 3: 108,958,592 V211A probably damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ints9 T A 14: 65,036,414 V556E probably benign Het
Klhl41 T C 2: 69,670,524 S110P probably benign Het
Kmt2e A T 5: 23,499,453 S1215C probably damaging Het
Lyn T C 4: 3,743,304 probably null Het
Map2k5 T A 9: 63,339,098 N116Y probably damaging Het
Map3k13 G T 16: 21,921,584 E554* probably null Het
Map6 A G 7: 99,268,440 E140G possibly damaging Het
Mpv17 A C 5: 31,154,103 probably null Het
Myo1c C T 11: 75,671,427 P883S probably benign Het
Myo7b T C 18: 31,983,926 M914V probably benign Het
Olfr124 G A 17: 37,805,652 C169Y probably damaging Het
Osbpl7 T G 11: 97,060,163 L612R probably damaging Het
Polq A T 16: 37,071,771 M2012L possibly damaging Het
Ppp1r7 G A 1: 93,346,278 D59N probably benign Het
Ptbp1 A C 10: 79,863,211 E534D probably benign Het
Qser1 A G 2: 104,789,475 Y241H probably damaging Het
Rbx1 T C 15: 81,473,877 L88P probably damaging Het
Rft1 T C 14: 30,689,881 L462P probably damaging Het
Serpinb9f T A 13: 33,327,307 L77* probably null Het
Slc12a2 T G 18: 57,879,209 F135V possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc44a2 T C 9: 21,342,199 F88L probably benign Het
Snx21 A G 2: 164,791,885 E197G probably damaging Het
Srarp T C 4: 141,433,396 D42G possibly damaging Het
Ssfa2 A T 2: 79,657,718 K715I probably damaging Het
St6galnac1 T A 11: 116,768,888 M200L probably benign Het
Stambpl1 A T 19: 34,234,001 Q154L probably benign Het
Szt2 G T 4: 118,392,836 R492S possibly damaging Het
Thbs3 G A 3: 89,225,391 R880Q probably benign Het
Tnks A T 8: 34,873,045 L473H probably damaging Het
Ttc4 A G 4: 106,665,696 S342P probably benign Het
Uckl1 T A 2: 181,569,719 M463L probably benign Het
Unc80 T C 1: 66,649,033 S2397P possibly damaging Het
Vmn2r73 T A 7: 85,857,920 H728L probably benign Het
Vsig10l T C 7: 43,463,954 V110A probably damaging Het
Zgrf1 T A 3: 127,560,915 L61* probably null Het
Zswim5 A G 4: 116,986,792 Y1009C probably damaging Het
Other mutations in Shisa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Shisa9 APN 16 12244658 missense probably benign 0.04
IGL02011:Shisa9 APN 16 12244638 missense possibly damaging 0.87
IGL02884:Shisa9 APN 16 11997043 splice site probably benign
PIT4508001:Shisa9 UTSW 16 12267480 missense probably benign 0.00
R0194:Shisa9 UTSW 16 11984954 missense probably damaging 1.00
R0309:Shisa9 UTSW 16 11997123 missense probably damaging 1.00
R0588:Shisa9 UTSW 16 12267774 missense probably damaging 0.99
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1469:Shisa9 UTSW 16 11985071 missense probably damaging 1.00
R1781:Shisa9 UTSW 16 12267657 missense probably benign 0.00
R1818:Shisa9 UTSW 16 12267562 missense probably damaging 0.96
R1943:Shisa9 UTSW 16 12267756 missense probably benign 0.06
R2263:Shisa9 UTSW 16 11984767 missense possibly damaging 0.53
R3742:Shisa9 UTSW 16 12267664 missense probably damaging 1.00
R5068:Shisa9 UTSW 16 12267548 missense possibly damaging 0.48
R5977:Shisa9 UTSW 16 12267428 missense probably benign 0.01
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6032:Shisa9 UTSW 16 11984908 missense possibly damaging 0.76
R6487:Shisa9 UTSW 16 12244611 missense probably benign 0.01
R6773:Shisa9 UTSW 16 11985028 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCTAACTGGAATGGCAGC -3'
(R):5'- ACCATGTCAACTTTTATGGTGC -3'

Sequencing Primer
(F):5'- CTCCCTGGAAGGAATGGCTTTC -3'
(R):5'- TTATGGTGCCAAACTCAGCATC -3'
Posted On2020-09-02