Incidental Mutation 'R8341:Map3k13'
ID 644916
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Name mitogen-activated protein kinase kinase kinase 13
Synonyms C130026N12Rik
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 21643923-21752189 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 21740334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 554 (E554*)
Ref Sequence ENSEMBL: ENSMUSP00000047388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
AlphaFold Q1HKZ5
Predicted Effect probably null
Transcript: ENSMUST00000042065
AA Change: E554*
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: E554*

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231988
AA Change: E554*
Predicted Effect probably null
Transcript: ENSMUST00000232240
AA Change: E554*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21,740,514 (GRCm39) missense probably benign 0.00
IGL01092:Map3k13 APN 16 21,746,766 (GRCm39) missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21,710,873 (GRCm39) missense probably benign
IGL02444:Map3k13 APN 16 21,732,982 (GRCm39) missense probably benign 0.19
IGL02503:Map3k13 APN 16 21,727,454 (GRCm39) missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21,724,005 (GRCm39) missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21,710,981 (GRCm39) missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21,732,975 (GRCm39) missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21,722,506 (GRCm39) missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21,732,907 (GRCm39) missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21,710,738 (GRCm39) missense probably benign
R0601:Map3k13 UTSW 16 21,723,999 (GRCm39) missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21,725,274 (GRCm39) missense probably benign 0.03
R0918:Map3k13 UTSW 16 21,744,990 (GRCm39) missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21,722,542 (GRCm39) missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21,732,939 (GRCm39) missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21,729,836 (GRCm39) missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21,710,894 (GRCm39) missense probably benign 0.01
R2332:Map3k13 UTSW 16 21,717,427 (GRCm39) splice site probably null
R2361:Map3k13 UTSW 16 21,725,286 (GRCm39) missense probably benign 0.05
R4395:Map3k13 UTSW 16 21,717,321 (GRCm39) missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4506:Map3k13 UTSW 16 21,740,928 (GRCm39) missense probably benign 0.00
R4521:Map3k13 UTSW 16 21,724,525 (GRCm39) missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21,710,752 (GRCm39) missense probably benign
R4952:Map3k13 UTSW 16 21,729,769 (GRCm39) missense probably benign 0.15
R5035:Map3k13 UTSW 16 21,740,421 (GRCm39) missense probably benign 0.03
R5327:Map3k13 UTSW 16 21,740,397 (GRCm39) missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21,717,391 (GRCm39) missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21,746,798 (GRCm39) makesense probably null
R5996:Map3k13 UTSW 16 21,723,995 (GRCm39) missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21,723,933 (GRCm39) missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21,740,527 (GRCm39) missense probably benign 0.15
R6620:Map3k13 UTSW 16 21,711,061 (GRCm39) missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21,711,062 (GRCm39) missense probably benign 0.32
R6692:Map3k13 UTSW 16 21,723,987 (GRCm39) missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21,741,028 (GRCm39) missense probably benign 0.10
R6743:Map3k13 UTSW 16 21,711,173 (GRCm39) missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21,741,013 (GRCm39) missense probably benign 0.00
R6965:Map3k13 UTSW 16 21,740,900 (GRCm39) missense probably benign
R7149:Map3k13 UTSW 16 21,744,187 (GRCm39) missense probably benign 0.04
R7174:Map3k13 UTSW 16 21,745,006 (GRCm39) missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21,710,988 (GRCm39) missense probably benign 0.03
R7400:Map3k13 UTSW 16 21,741,072 (GRCm39) missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21,740,436 (GRCm39) missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21,724,621 (GRCm39) missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21,740,346 (GRCm39) missense probably benign 0.09
R7876:Map3k13 UTSW 16 21,741,069 (GRCm39) missense probably benign 0.00
R8002:Map3k13 UTSW 16 21,723,878 (GRCm39) missense probably benign 0.05
R8089:Map3k13 UTSW 16 21,722,567 (GRCm39) missense possibly damaging 0.48
R8738:Map3k13 UTSW 16 21,745,008 (GRCm39) missense probably damaging 1.00
R8940:Map3k13 UTSW 16 21,727,454 (GRCm39) missense possibly damaging 0.50
R8949:Map3k13 UTSW 16 21,723,882 (GRCm39) missense probably benign 0.05
R9391:Map3k13 UTSW 16 21,740,665 (GRCm39) missense probably benign 0.00
R9749:Map3k13 UTSW 16 21,740,581 (GRCm39) missense probably benign 0.00
R9802:Map3k13 UTSW 16 21,740,518 (GRCm39) missense possibly damaging 0.85
Z1176:Map3k13 UTSW 16 21,723,912 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGTGCTGACTGAAAGAG -3'
(R):5'- ATGGACTGAAGCGCACTGAG -3'

Sequencing Primer
(F):5'- GAAGCCTGATAGCTCCAGGATTC -3'
(R):5'- TGAAGCGCACTGAGCCTGAG -3'
Posted On 2020-09-02