Incidental Mutation 'R8341:Bace2'
ID644918
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Namebeta-site APP-cleaving enzyme 2
Synonyms1110059C24Rik, ARP1, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8341 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location97356742-97442936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97356908 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 36 (A36V)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047275
AA Change: A36V

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: A36V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Meta Mutation Damage Score 0.1926 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik A T X: 89,754,716 K718M probably damaging Het
Abca8b T A 11: 109,955,050 I915F probably damaging Het
Adam11 C A 11: 102,776,536 H641N probably damaging Het
Amfr A G 8: 93,999,178 S192P probably damaging Het
Ano9 T A 7: 141,102,334 N676I possibly damaging Het
Arfgef1 C T 1: 10,154,328 V1428I probably benign Het
B3gnt9 C T 8: 105,253,865 R297H probably benign Het
C1s1 C T 6: 124,531,156 A625T probably damaging Het
Camkmt T C 17: 85,439,580 L251P probably damaging Het
Ceacam15 C A 7: 16,672,003 V208F probably benign Het
Clp1 T C 2: 84,723,773 K351E probably damaging Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Cubn C A 2: 13,428,724 G1125V probably damaging Het
Dpp4 C T 2: 62,347,890 V633I probably benign Het
Eif2ak1 A T 5: 143,884,937 D357V probably benign Het
Fez1 T C 9: 36,876,309 M370T possibly damaging Het
Frk G A 10: 34,586,283 E257K probably damaging Het
Gm7579 T A 7: 142,212,119 C87* probably null Het
Henmt1 T C 3: 108,958,592 V211A probably damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ints9 T A 14: 65,036,414 V556E probably benign Het
Klhl41 T C 2: 69,670,524 S110P probably benign Het
Klrk1 T C 6: 129,622,700 probably benign Het
Kmt2e A T 5: 23,499,453 S1215C probably damaging Het
Lyn T C 4: 3,743,304 probably null Het
Map2k5 T A 9: 63,339,098 N116Y probably damaging Het
Map3k13 G T 16: 21,921,584 E554* probably null Het
Map6 A G 7: 99,268,440 E140G possibly damaging Het
Mpv17 A C 5: 31,154,103 probably null Het
Myo1c C T 11: 75,671,427 P883S probably benign Het
Myo7b T C 18: 31,983,926 M914V probably benign Het
Olfm2 C T 9: 20,672,622 probably null Het
Olfr124 G A 17: 37,805,652 C169Y probably damaging Het
Osbpl7 T G 11: 97,060,163 L612R probably damaging Het
Polq A T 16: 37,071,771 M2012L possibly damaging Het
Ppp1r7 G A 1: 93,346,278 D59N probably benign Het
Ptbp1 A C 10: 79,863,211 E534D probably benign Het
Qser1 A G 2: 104,789,475 Y241H probably damaging Het
Rbx1 T C 15: 81,473,877 L88P probably damaging Het
Rft1 T C 14: 30,689,881 L462P probably damaging Het
Serpinb9f T A 13: 33,327,307 L77* probably null Het
Shisa9 T C 16: 11,997,151 M221T possibly damaging Het
Slc12a2 T G 18: 57,879,209 F135V possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc44a2 T C 9: 21,342,199 F88L probably benign Het
Snx21 A G 2: 164,791,885 E197G probably damaging Het
Srarp T C 4: 141,433,396 D42G possibly damaging Het
Ssfa2 A T 2: 79,657,718 K715I probably damaging Het
St6galnac1 T A 11: 116,768,888 M200L probably benign Het
Stambpl1 A T 19: 34,234,001 Q154L probably benign Het
Szt2 G T 4: 118,392,836 R492S possibly damaging Het
Thbs3 G A 3: 89,225,391 R880Q probably benign Het
Tnks A T 8: 34,873,045 L473H probably damaging Het
Ttc4 A G 4: 106,665,696 S342P probably benign Het
Uckl1 T A 2: 181,569,719 M463L probably benign Het
Unc80 T C 1: 66,649,033 S2397P possibly damaging Het
Vmn2r73 T A 7: 85,857,920 H728L probably benign Het
Vsig10l T C 7: 43,463,954 V110A probably damaging Het
Zgrf1 T A 3: 127,560,915 L61* probably null Het
Zswim5 A G 4: 116,986,792 Y1009C probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97408430 missense probably damaging 0.97
IGL02660:Bace2 APN 16 97415140 missense probably damaging 1.00
IGL02669:Bace2 APN 16 97436893 makesense probably null
R0244:Bace2 UTSW 16 97436773 splice site probably null
R0674:Bace2 UTSW 16 97436749 missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97356941 missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97356860 missense unknown
R1670:Bace2 UTSW 16 97412135 missense probably damaging 0.96
R1997:Bace2 UTSW 16 97415089 missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97412136 missense probably damaging 1.00
R2937:Bace2 UTSW 16 97412188 critical splice donor site probably null
R2938:Bace2 UTSW 16 97412188 critical splice donor site probably null
R3103:Bace2 UTSW 16 97422001 critical splice donor site probably null
R3755:Bace2 UTSW 16 97436657 missense probably benign 0.34
R4110:Bace2 UTSW 16 97436656 missense probably benign
R4112:Bace2 UTSW 16 97436656 missense probably benign
R4113:Bace2 UTSW 16 97436656 missense probably benign
R4560:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4562:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4563:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4717:Bace2 UTSW 16 97436873 missense probably damaging 1.00
R5535:Bace2 UTSW 16 97413425 missense probably damaging 1.00
R6282:Bace2 UTSW 16 97415097 missense probably damaging 1.00
R6364:Bace2 UTSW 16 97413433 missense probably benign 0.05
R7045:Bace2 UTSW 16 97399665 missense probably damaging 1.00
R7241:Bace2 UTSW 16 97436798 missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97399682 missense probably benign 0.01
R7653:Bace2 UTSW 16 97436652 missense
R8026:Bace2 UTSW 16 97436852 missense probably benign 0.26
R8171:Bace2 UTSW 16 97424586 missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97413470 missense probably damaging 1.00
X0024:Bace2 UTSW 16 97413398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGACTGAGAACTTGTTCAACTC -3'
(R):5'- CAGCATCTCTAGGTAGTAGCCG -3'

Sequencing Primer
(F):5'- GAGAACTTGTTCAACTCTGCACCG -3'
(R):5'- TAGGTAGTAGCCGCGGCC -3'
Posted On2020-09-02