Incidental Mutation 'R8341:Bace2'
ID 644918
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8341 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 97158108 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 36 (A36V)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047275
AA Change: A36V

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: A36V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Meta Mutation Damage Score 0.1926 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc12a2 T G 18: 58,012,281 (GRCm39) F135V possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGACTGAGAACTTGTTCAACTC -3'
(R):5'- CAGCATCTCTAGGTAGTAGCCG -3'

Sequencing Primer
(F):5'- GAGAACTTGTTCAACTCTGCACCG -3'
(R):5'- TAGGTAGTAGCCGCGGCC -3'
Posted On 2020-09-02