Incidental Mutation 'R8341:Myo7b'
ID644921
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Namemyosin VIIB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8341 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location31959234-32036961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31983926 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 914 (M914V)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: M914V

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: M914V

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik A T X: 89,754,716 K718M probably damaging Het
Abca8b T A 11: 109,955,050 I915F probably damaging Het
Adam11 C A 11: 102,776,536 H641N probably damaging Het
Amfr A G 8: 93,999,178 S192P probably damaging Het
Ano9 T A 7: 141,102,334 N676I possibly damaging Het
Arfgef1 C T 1: 10,154,328 V1428I probably benign Het
B3gnt9 C T 8: 105,253,865 R297H probably benign Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
C1s1 C T 6: 124,531,156 A625T probably damaging Het
Camkmt T C 17: 85,439,580 L251P probably damaging Het
Ceacam15 C A 7: 16,672,003 V208F probably benign Het
Clp1 T C 2: 84,723,773 K351E probably damaging Het
Csmd3 T C 15: 47,698,151 Y1343C Het
Cubn C A 2: 13,428,724 G1125V probably damaging Het
Dpp4 C T 2: 62,347,890 V633I probably benign Het
Eif2ak1 A T 5: 143,884,937 D357V probably benign Het
Fez1 T C 9: 36,876,309 M370T possibly damaging Het
Frk G A 10: 34,586,283 E257K probably damaging Het
Gm7579 T A 7: 142,212,119 C87* probably null Het
Henmt1 T C 3: 108,958,592 V211A probably damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ints9 T A 14: 65,036,414 V556E probably benign Het
Klhl41 T C 2: 69,670,524 S110P probably benign Het
Klrk1 T C 6: 129,622,700 probably benign Het
Kmt2e A T 5: 23,499,453 S1215C probably damaging Het
Lyn T C 4: 3,743,304 probably null Het
Map2k5 T A 9: 63,339,098 N116Y probably damaging Het
Map3k13 G T 16: 21,921,584 E554* probably null Het
Map6 A G 7: 99,268,440 E140G possibly damaging Het
Mpv17 A C 5: 31,154,103 probably null Het
Myo1c C T 11: 75,671,427 P883S probably benign Het
Olfm2 C T 9: 20,672,622 probably null Het
Olfr124 G A 17: 37,805,652 C169Y probably damaging Het
Osbpl7 T G 11: 97,060,163 L612R probably damaging Het
Polq A T 16: 37,071,771 M2012L possibly damaging Het
Ppp1r7 G A 1: 93,346,278 D59N probably benign Het
Ptbp1 A C 10: 79,863,211 E534D probably benign Het
Qser1 A G 2: 104,789,475 Y241H probably damaging Het
Rbx1 T C 15: 81,473,877 L88P probably damaging Het
Rft1 T C 14: 30,689,881 L462P probably damaging Het
Serpinb9f T A 13: 33,327,307 L77* probably null Het
Shisa9 T C 16: 11,997,151 M221T possibly damaging Het
Slc12a2 T G 18: 57,879,209 F135V possibly damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc44a2 T C 9: 21,342,199 F88L probably benign Het
Snx21 A G 2: 164,791,885 E197G probably damaging Het
Srarp T C 4: 141,433,396 D42G possibly damaging Het
Ssfa2 A T 2: 79,657,718 K715I probably damaging Het
St6galnac1 T A 11: 116,768,888 M200L probably benign Het
Stambpl1 A T 19: 34,234,001 Q154L probably benign Het
Szt2 G T 4: 118,392,836 R492S possibly damaging Het
Thbs3 G A 3: 89,225,391 R880Q probably benign Het
Tnks A T 8: 34,873,045 L473H probably damaging Het
Ttc4 A G 4: 106,665,696 S342P probably benign Het
Uckl1 T A 2: 181,569,719 M463L probably benign Het
Unc80 T C 1: 66,649,033 S2397P possibly damaging Het
Vmn2r73 T A 7: 85,857,920 H728L probably benign Het
Vsig10l T C 7: 43,463,954 V110A probably damaging Het
Zgrf1 T A 3: 127,560,915 L61* probably null Het
Zswim5 A G 4: 116,986,792 Y1009C probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGACATGGGCCAACCT -3'
(R):5'- AAGTACTTGTCATATTTCCTGTTCC -3'

Sequencing Primer
(F):5'- GCCAACCTTTCAGTCAGTGGAATG -3'
(R):5'- ATAGAATGGTGCCACCTGTGC -3'
Posted On2020-09-02