Incidental Mutation 'R8341:Slc12a2'
ID 644923
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Name solute carrier family 12, member 2
Synonyms sy-ns, Nkcc1, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission 067865-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8341 (G1)
Quality Score 190.009
Status Not validated
Chromosome 18
Chromosomal Location 58011750-58079893 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58012281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 135 (F135V)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000115366
AA Change: F135V

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: F135V

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,845,876 (GRCm39) I915F probably damaging Het
Adam11 C A 11: 102,667,362 (GRCm39) H641N probably damaging Het
Amfr A G 8: 94,725,806 (GRCm39) S192P probably damaging Het
Ano9 T A 7: 140,682,247 (GRCm39) N676I possibly damaging Het
Arfgef1 C T 1: 10,224,553 (GRCm39) V1428I probably benign Het
B3gnt9 C T 8: 105,980,497 (GRCm39) R297H probably benign Het
Bace2 C T 16: 97,158,108 (GRCm39) A36V possibly damaging Het
C1s1 C T 6: 124,508,115 (GRCm39) A625T probably damaging Het
Camkmt T C 17: 85,747,008 (GRCm39) L251P probably damaging Het
Ceacam15 C A 7: 16,405,928 (GRCm39) V208F probably benign Het
Clp1 T C 2: 84,554,117 (GRCm39) K351E probably damaging Het
Csmd3 T C 15: 47,561,547 (GRCm39) Y1343C Het
Cubn C A 2: 13,433,535 (GRCm39) G1125V probably damaging Het
Dpp4 C T 2: 62,178,234 (GRCm39) V633I probably benign Het
Eif2ak1 A T 5: 143,821,755 (GRCm39) D357V probably benign Het
Fez1 T C 9: 36,787,605 (GRCm39) M370T possibly damaging Het
Frk G A 10: 34,462,279 (GRCm39) E257K probably damaging Het
Gm7579 T A 7: 141,765,856 (GRCm39) C87* probably null Het
Henmt1 T C 3: 108,865,908 (GRCm39) V211A probably damaging Het
Hspg2 C G 4: 137,246,290 (GRCm39) P1023A possibly damaging Het
Ints9 T A 14: 65,273,863 (GRCm39) V556E probably benign Het
Itprid2 A T 2: 79,488,062 (GRCm39) K715I probably damaging Het
Klhl41 T C 2: 69,500,868 (GRCm39) S110P probably benign Het
Klrk1 T C 6: 129,599,663 (GRCm39) probably benign Het
Kmt2e A T 5: 23,704,451 (GRCm39) S1215C probably damaging Het
Lyn T C 4: 3,743,304 (GRCm39) probably null Het
Map2k5 T A 9: 63,246,380 (GRCm39) N116Y probably damaging Het
Map3k13 G T 16: 21,740,334 (GRCm39) E554* probably null Het
Map6 A G 7: 98,917,647 (GRCm39) E140G possibly damaging Het
Mpv17 A C 5: 31,311,447 (GRCm39) probably null Het
Myo1c C T 11: 75,562,253 (GRCm39) P883S probably benign Het
Myo7b T C 18: 32,116,979 (GRCm39) M914V probably benign Het
Olfm2 C T 9: 20,583,918 (GRCm39) probably null Het
Or2b4 G A 17: 38,116,543 (GRCm39) C169Y probably damaging Het
Osbpl7 T G 11: 96,950,989 (GRCm39) L612R probably damaging Het
Polq A T 16: 36,892,133 (GRCm39) M2012L possibly damaging Het
Ppp1r7 G A 1: 93,274,000 (GRCm39) D59N probably benign Het
Ppp4r3c2 A T X: 88,798,322 (GRCm39) K718M probably damaging Het
Ptbp1 A C 10: 79,699,045 (GRCm39) E534D probably benign Het
Qser1 A G 2: 104,619,820 (GRCm39) Y241H probably damaging Het
Rbx1 T C 15: 81,358,078 (GRCm39) L88P probably damaging Het
Rft1 T C 14: 30,411,838 (GRCm39) L462P probably damaging Het
Serpinb9f T A 13: 33,511,290 (GRCm39) L77* probably null Het
Shisa9 T C 16: 11,815,015 (GRCm39) M221T possibly damaging Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc44a2 T C 9: 21,253,495 (GRCm39) F88L probably benign Het
Snx21 A G 2: 164,633,805 (GRCm39) E197G probably damaging Het
Srarp T C 4: 141,160,707 (GRCm39) D42G possibly damaging Het
St6galnac1 T A 11: 116,659,714 (GRCm39) M200L probably benign Het
Stambpl1 A T 19: 34,211,401 (GRCm39) Q154L probably benign Het
Szt2 G T 4: 118,250,033 (GRCm39) R492S possibly damaging Het
Thbs3 G A 3: 89,132,698 (GRCm39) R880Q probably benign Het
Tnks A T 8: 35,340,199 (GRCm39) L473H probably damaging Het
Ttc4 A G 4: 106,522,893 (GRCm39) S342P probably benign Het
Uckl1 T A 2: 181,211,512 (GRCm39) M463L probably benign Het
Unc80 T C 1: 66,688,192 (GRCm39) S2397P possibly damaging Het
Vmn2r73 T A 7: 85,507,128 (GRCm39) H728L probably benign Het
Vsig10l T C 7: 43,113,378 (GRCm39) V110A probably damaging Het
Zgrf1 T A 3: 127,354,564 (GRCm39) L61* probably null Het
Zswim5 A G 4: 116,843,989 (GRCm39) Y1009C probably damaging Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 58,069,477 (GRCm39) missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 58,039,092 (GRCm39) nonsense probably null
IGL01896:Slc12a2 APN 18 58,029,380 (GRCm39) missense probably benign 0.06
IGL02266:Slc12a2 APN 18 58,045,092 (GRCm39) splice site probably benign
IGL02489:Slc12a2 APN 18 58,045,074 (GRCm39) missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 58,012,471 (GRCm39) missense probably benign 0.25
IGL03068:Slc12a2 APN 18 58,037,407 (GRCm39) splice site probably benign
IGL03076:Slc12a2 APN 18 58,059,469 (GRCm39) splice site probably benign
IGL03086:Slc12a2 APN 18 58,054,856 (GRCm39) missense probably benign 0.00
IGL03238:Slc12a2 APN 18 58,047,306 (GRCm39) missense possibly damaging 0.85
frankie UTSW 18 58,068,035 (GRCm39) missense possibly damaging 0.48
honeylamb UTSW 18 58,063,238 (GRCm39) missense probably damaging 1.00
sugar UTSW 18 58,032,344 (GRCm39) missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 58,048,594 (GRCm39) splice site probably benign
R0194:Slc12a2 UTSW 18 58,063,283 (GRCm39) missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 58,052,608 (GRCm39) missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 58,037,450 (GRCm39) missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 58,054,882 (GRCm39) missense probably benign 0.00
R1112:Slc12a2 UTSW 18 58,070,824 (GRCm39) missense probably benign 0.01
R1544:Slc12a2 UTSW 18 58,012,374 (GRCm39) missense probably benign 0.00
R1669:Slc12a2 UTSW 18 58,037,307 (GRCm39) missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 58,037,425 (GRCm39) missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 58,012,467 (GRCm39) missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 58,043,358 (GRCm39) missense possibly damaging 0.61
R2340:Slc12a2 UTSW 18 58,033,122 (GRCm39) missense probably benign 0.03
R3971:Slc12a2 UTSW 18 58,063,268 (GRCm39) missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 58,032,427 (GRCm39) missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 58,043,328 (GRCm39) missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 58,046,037 (GRCm39) splice site probably null
R4678:Slc12a2 UTSW 18 58,039,032 (GRCm39) nonsense probably null
R4931:Slc12a2 UTSW 18 58,068,035 (GRCm39) missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 58,032,344 (GRCm39) missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 58,012,092 (GRCm39) missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 58,029,382 (GRCm39) missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 58,029,426 (GRCm39) missense probably benign 0.01
R5789:Slc12a2 UTSW 18 58,045,091 (GRCm39) splice site probably null
R5868:Slc12a2 UTSW 18 58,077,068 (GRCm39) missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 58,065,595 (GRCm39) missense probably benign 0.06
R6126:Slc12a2 UTSW 18 58,077,116 (GRCm39) missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 58,048,578 (GRCm39) missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 58,031,145 (GRCm39) missense probably benign 0.01
R6615:Slc12a2 UTSW 18 58,031,200 (GRCm39) missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 58,052,541 (GRCm39) missense probably benign 0.05
R6957:Slc12a2 UTSW 18 58,043,344 (GRCm39) nonsense probably null
R7411:Slc12a2 UTSW 18 58,074,085 (GRCm39) missense probably benign 0.01
R7508:Slc12a2 UTSW 18 58,037,465 (GRCm39) missense probably benign 0.01
R7645:Slc12a2 UTSW 18 58,029,450 (GRCm39) missense possibly damaging 0.94
R7658:Slc12a2 UTSW 18 58,065,596 (GRCm39) missense probably benign 0.02
R8054:Slc12a2 UTSW 18 58,054,944 (GRCm39) nonsense probably null
R8093:Slc12a2 UTSW 18 58,012,423 (GRCm39) missense probably benign 0.17
R8099:Slc12a2 UTSW 18 58,032,464 (GRCm39) missense probably damaging 0.99
R8121:Slc12a2 UTSW 18 58,032,403 (GRCm39) missense probably benign 0.44
R8214:Slc12a2 UTSW 18 58,070,791 (GRCm39) missense probably benign 0.29
R8273:Slc12a2 UTSW 18 58,047,338 (GRCm39) splice site probably benign
R8485:Slc12a2 UTSW 18 58,074,218 (GRCm39) critical splice donor site probably null
R8797:Slc12a2 UTSW 18 58,012,455 (GRCm39) missense possibly damaging 0.80
R9049:Slc12a2 UTSW 18 58,054,863 (GRCm39) nonsense probably null
R9180:Slc12a2 UTSW 18 58,069,469 (GRCm39) missense possibly damaging 0.83
R9256:Slc12a2 UTSW 18 58,074,867 (GRCm39) missense probably damaging 1.00
R9337:Slc12a2 UTSW 18 58,063,238 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGATGCTACTACGGCTG -3'
(R):5'- TTTTCCAGCTCATCGTGGAG -3'

Sequencing Primer
(F):5'- ATGCTACTACGGCTGGGAGG -3'
(R):5'- TAGTGGTCGATCCTGGGCAC -3'
Posted On 2020-09-02