Incidental Mutation 'R8342:Ankar'
ID 644925
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Name ankyrin and armadillo repeat containing
Synonyms 4932422E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 72642980-72700579 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72652460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1114 (V1114A)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
AlphaFold A2RT91
Predicted Effect probably damaging
Transcript: ENSMUST00000053499
AA Change: V1114A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: V1114A

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211837
AA Change: V1113A

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000212573
AA Change: V896A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,257,005 probably null Het
Aak1 A G 6: 86,986,339 D917G unknown Het
Adad1 T C 3: 37,079,901 S322P probably damaging Het
Agbl4 C T 4: 111,119,027 L194F probably damaging Het
Ahr C T 12: 35,508,272 G250R probably damaging Het
AI987944 A T 7: 41,374,886 I226N probably benign Het
Ankrd49 C A 9: 14,781,527 A114S probably damaging Het
Arl6 C T 16: 59,622,439 G140D unknown Het
Arrdc3 A G 13: 80,883,671 S8G probably benign Het
Ate1 A T 7: 130,503,765 V298E probably benign Het
Atp6v1b2 A G 8: 69,101,383 I71V probably benign Het
Bin1 A G 18: 32,413,113 M112V probably benign Het
Camk2b C T 11: 5,990,383 A152T probably benign Het
Cars2 A C 8: 11,529,706 F251V probably damaging Het
Cdkl1 A T 12: 69,754,178 F229I probably damaging Het
Ceacam5 A T 7: 17,752,246 Y556F possibly damaging Het
Chst15 T C 7: 132,247,886 N442S probably benign Het
Ckap5 T A 2: 91,606,362 D1602E possibly damaging Het
Col9a3 A T 2: 180,603,390 I131F unknown Het
Cyp4f15 A T 17: 32,690,759 D110V possibly damaging Het
Dlec1 A G 9: 119,139,389 I1258V probably benign Het
Dpyd A G 3: 119,314,803 T832A possibly damaging Het
Eno1 A G 4: 150,245,236 Y189C probably damaging Het
Gm12800 A T 4: 101,910,384 M277L probably benign Het
Gnat3 A G 5: 18,003,840 T181A Het
Kif1b T C 4: 149,222,348 M852V probably damaging Het
Klk1b26 A T 7: 44,016,084 I139F probably damaging Het
Loxhd1 G A 18: 77,405,985 V1547M possibly damaging Het
Lrp4 A G 2: 91,488,445 T876A probably damaging Het
Malrd1 G T 2: 15,633,224 W451L unknown Het
March6 A T 15: 31,494,116 N261K possibly damaging Het
Mcpt2 T C 14: 56,042,793 C50R probably damaging Het
Muc16 A G 9: 18,658,685 V846A unknown Het
Muc5b A T 7: 141,860,865 D2516V unknown Het
Myh15 T C 16: 49,092,757 L359P probably benign Het
Nemp1 G A 10: 127,693,029 V201I probably benign Het
Nr2e1 A T 10: 42,568,429 L228Q probably damaging Het
Nrg1 C A 8: 31,822,306 V388L probably benign Het
Nrg3 T A 14: 39,012,096 T278S probably damaging Het
Numb T C 12: 83,808,216 E112G probably benign Het
Olfr364-ps1 T C 2: 37,146,766 S185P probably damaging Het
Olfr971 A C 9: 39,840,316 N294T probably damaging Het
Pdlim2 C A 14: 70,166,114 C283F probably damaging Het
Ppm1a G A 12: 72,784,135 G145R probably damaging Het
Pramef17 T A 4: 143,994,239 D44V probably benign Het
Prune2 C A 19: 17,125,663 Q2729K probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn9a G T 2: 66,536,282 T719K probably benign Het
Slc12a7 T C 13: 73,785,162 V113A probably benign Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc37a2 A T 9: 37,238,214 probably null Het
Steap1 G A 5: 5,740,816 S44L probably benign Het
Sucnr1 C T 3: 60,086,734 R228C probably damaging Het
Sult3a1 G A 10: 33,866,521 G48D probably damaging Het
Syn3 A T 10: 86,467,027 V88D probably damaging Het
Syne1 T C 10: 5,108,622 D7297G probably benign Het
Tmco5 T C 2: 116,880,253 I18T probably damaging Het
Trpc1 A G 9: 95,726,548 L230P probably damaging Het
Ttn T C 2: 76,889,441 N7108S unknown Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt1a7c T C 1: 88,095,251 V44A possibly damaging Het
Vmn2r60 A T 7: 42,141,070 S494C possibly damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6296:Ankar UTSW 1 72643258 missense probably damaging 1.00
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8494:Ankar UTSW 1 72658794 missense probably benign 0.16
R8851:Ankar UTSW 1 72652376 missense probably damaging 1.00
R8970:Ankar UTSW 1 72652337 critical splice donor site probably null
R9228:Ankar UTSW 1 72674051 missense probably benign 0.27
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTTGCCATGGAGAGCATTTAG -3'
(R):5'- GAACAGTCCTGCAGAAGCTGTG -3'

Sequencing Primer
(F):5'- GCCATGGAGAGCATTTAGTCATAAC -3'
(R):5'- CCTGCAGAAGCTGTGTTAGTC -3'
Posted On 2020-09-02