Incidental Mutation 'R8342:Gm12800'
ID644939
Institutional Source Beutler Lab
Gene Symbol Gm12800
Ensembl Gene ENSMUSG00000037028
Gene Namepredicted gene 12800
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8342 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location101909121-101911908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101910384 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 277 (M277L)
Ref Sequence ENSEMBL: ENSMUSP00000075380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075999]
Predicted Effect probably benign
Transcript: ENSMUST00000075999
AA Change: M277L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000075380
Gene: ENSMUSG00000037028
AA Change: M277L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 206 410 9e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,257,005 probably null Het
Aak1 A G 6: 86,986,339 D917G unknown Het
Adad1 T C 3: 37,079,901 S322P probably damaging Het
Agbl4 C T 4: 111,119,027 L194F probably damaging Het
Ahr C T 12: 35,508,272 G250R probably damaging Het
AI987944 A T 7: 41,374,886 I226N probably benign Het
Ankar A G 1: 72,652,460 V1114A probably damaging Het
Ankrd49 C A 9: 14,781,527 A114S probably damaging Het
Arl6 C T 16: 59,622,439 G140D unknown Het
Arrdc3 A G 13: 80,883,671 S8G probably benign Het
Ate1 A T 7: 130,503,765 V298E probably benign Het
Atp6v1b2 A G 8: 69,101,383 I71V probably benign Het
Bin1 A G 18: 32,413,113 M112V probably benign Het
Camk2b C T 11: 5,990,383 A152T probably benign Het
Cars2 A C 8: 11,529,706 F251V probably damaging Het
Cdkl1 A T 12: 69,754,178 F229I probably damaging Het
Ceacam5 A T 7: 17,752,246 Y556F possibly damaging Het
Chst15 T C 7: 132,247,886 N442S probably benign Het
Ckap5 T A 2: 91,606,362 D1602E possibly damaging Het
Col9a3 A T 2: 180,603,390 I131F unknown Het
Cyp4f15 A T 17: 32,690,759 D110V possibly damaging Het
Dlec1 A G 9: 119,139,389 I1258V probably benign Het
Dpyd A G 3: 119,314,803 T832A possibly damaging Het
Eno1 A G 4: 150,245,236 Y189C probably damaging Het
Gnat3 A G 5: 18,003,840 T181A Het
Kif1b T C 4: 149,222,348 M852V probably damaging Het
Klk1b26 A T 7: 44,016,084 I139F probably damaging Het
Loxhd1 G A 18: 77,405,985 V1547M possibly damaging Het
Lrp4 A G 2: 91,488,445 T876A probably damaging Het
Malrd1 G T 2: 15,633,224 W451L unknown Het
March6 A T 15: 31,494,116 N261K possibly damaging Het
Mcpt2 T C 14: 56,042,793 C50R probably damaging Het
Muc16 A G 9: 18,658,685 V846A unknown Het
Muc5b A T 7: 141,860,865 D2516V unknown Het
Myh15 T C 16: 49,092,757 L359P probably benign Het
Nemp1 G A 10: 127,693,029 V201I probably benign Het
Nr2e1 A T 10: 42,568,429 L228Q probably damaging Het
Nrg1 C A 8: 31,822,306 V388L probably benign Het
Nrg3 T A 14: 39,012,096 T278S probably damaging Het
Numb T C 12: 83,808,216 E112G probably benign Het
Olfr364-ps1 T C 2: 37,146,766 S185P probably damaging Het
Olfr971 A C 9: 39,840,316 N294T probably damaging Het
Pdlim2 C A 14: 70,166,114 C283F probably damaging Het
Ppm1a G A 12: 72,784,135 G145R probably damaging Het
Pramef17 T A 4: 143,994,239 D44V probably benign Het
Prune2 C A 19: 17,125,663 Q2729K probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn9a G T 2: 66,536,282 T719K probably benign Het
Slc12a7 T C 13: 73,785,162 V113A probably benign Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc37a2 A T 9: 37,238,214 probably null Het
Steap1 G A 5: 5,740,816 S44L probably benign Het
Sucnr1 C T 3: 60,086,734 R228C probably damaging Het
Sult3a1 G A 10: 33,866,521 G48D probably damaging Het
Syn3 A T 10: 86,467,027 V88D probably damaging Het
Syne1 T C 10: 5,108,622 D7297G probably benign Het
Tmco5 T C 2: 116,880,253 I18T probably damaging Het
Trpc1 A G 9: 95,726,548 L230P probably damaging Het
Ttn T C 2: 76,889,441 N7108S unknown Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt1a7c T C 1: 88,095,251 V44A possibly damaging Het
Vmn2r60 A T 7: 42,141,070 S494C possibly damaging Het
Other mutations in Gm12800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Gm12800 APN 4 101910280 missense probably benign 0.02
IGL02683:Gm12800 APN 4 101910354 missense probably benign 0.00
IGL03403:Gm12800 APN 4 101909928 missense probably benign 0.40
R0833:Gm12800 UTSW 4 101910097 missense probably damaging 0.97
R1054:Gm12800 UTSW 4 101909164 missense probably benign 0.00
R1953:Gm12800 UTSW 4 101910115 missense probably benign
R2216:Gm12800 UTSW 4 101910060 missense probably damaging 0.99
R3746:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R3747:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R3750:Gm12800 UTSW 4 101909876 missense possibly damaging 0.63
R4931:Gm12800 UTSW 4 101909170 missense possibly damaging 0.47
R5102:Gm12800 UTSW 4 101909239 missense probably damaging 1.00
R5586:Gm12800 UTSW 4 101910120 missense probably benign 0.00
R5822:Gm12800 UTSW 4 101910243 missense probably damaging 1.00
R6395:Gm12800 UTSW 4 101909992 missense probably benign
R6904:Gm12800 UTSW 4 101910094 missense possibly damaging 0.86
R7544:Gm12800 UTSW 4 101911402 missense possibly damaging 0.56
R7768:Gm12800 UTSW 4 101911813 missense probably benign
Z1088:Gm12800 UTSW 4 101910186 missense probably benign 0.00
Z1088:Gm12800 UTSW 4 101909118 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACACAAATCAGGTCCTATCCTTTC -3'
(R):5'- GGGATTGAATCAAGTGAGCTCC -3'

Sequencing Primer
(F):5'- AATCAGGTCCTATCCTTTCTAAGTTG -3'
(R):5'- TCAAGTGAGCTCCATTAAGAAGG -3'
Posted On2020-09-02