Incidental Mutation 'R8342:Klk1b26'
ID644951
Institutional Source Beutler Lab
Gene Symbol Klk1b26
Ensembl Gene ENSMUSG00000053719
Gene Namekallikrein 1-related petidase b26
SynonymsEGF-BP type B, Egfbp2, PRECE-2, Klk26, mGK-26
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8342 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44012168-44016968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44016084 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 139 (I139F)
Ref Sequence ENSEMBL: ENSMUSP00000047488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048945]
Predicted Effect probably damaging
Transcript: ENSMUST00000048945
AA Change: I139F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047488
Gene: ENSMUSG00000053719
AA Change: I139F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 2.29e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. The kallikrein genes are present in a large gene cluster on chromosome 7. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of this gene in the submandibular gland is sexually dimorphic likely due to both transcriptional and post-transcriptional regulation. This gene is thought to be distinct from the Egfbp2 gene (Gene ID: 13647), with which it shares 98% identity (PMIDs: 1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,257,005 probably null Het
Aak1 A G 6: 86,986,339 D917G unknown Het
Adad1 T C 3: 37,079,901 S322P probably damaging Het
Agbl4 C T 4: 111,119,027 L194F probably damaging Het
Ahr C T 12: 35,508,272 G250R probably damaging Het
AI987944 A T 7: 41,374,886 I226N probably benign Het
Ankar A G 1: 72,652,460 V1114A probably damaging Het
Ankrd49 C A 9: 14,781,527 A114S probably damaging Het
Arl6 C T 16: 59,622,439 G140D unknown Het
Arrdc3 A G 13: 80,883,671 S8G probably benign Het
Ate1 A T 7: 130,503,765 V298E probably benign Het
Atp6v1b2 A G 8: 69,101,383 I71V probably benign Het
Bin1 A G 18: 32,413,113 M112V probably benign Het
Camk2b C T 11: 5,990,383 A152T probably benign Het
Cars2 A C 8: 11,529,706 F251V probably damaging Het
Cdkl1 A T 12: 69,754,178 F229I probably damaging Het
Ceacam5 A T 7: 17,752,246 Y556F possibly damaging Het
Chst15 T C 7: 132,247,886 N442S probably benign Het
Ckap5 T A 2: 91,606,362 D1602E possibly damaging Het
Col9a3 A T 2: 180,603,390 I131F unknown Het
Cyp4f15 A T 17: 32,690,759 D110V possibly damaging Het
Dlec1 A G 9: 119,139,389 I1258V probably benign Het
Dpyd A G 3: 119,314,803 T832A possibly damaging Het
Eno1 A G 4: 150,245,236 Y189C probably damaging Het
Gm12800 A T 4: 101,910,384 M277L probably benign Het
Gnat3 A G 5: 18,003,840 T181A Het
Kif1b T C 4: 149,222,348 M852V probably damaging Het
Loxhd1 G A 18: 77,405,985 V1547M possibly damaging Het
Lrp4 A G 2: 91,488,445 T876A probably damaging Het
Malrd1 G T 2: 15,633,224 W451L unknown Het
March6 A T 15: 31,494,116 N261K possibly damaging Het
Mcpt2 T C 14: 56,042,793 C50R probably damaging Het
Muc16 A G 9: 18,658,685 V846A unknown Het
Muc5b A T 7: 141,860,865 D2516V unknown Het
Myh15 T C 16: 49,092,757 L359P probably benign Het
Nemp1 G A 10: 127,693,029 V201I probably benign Het
Nr2e1 A T 10: 42,568,429 L228Q probably damaging Het
Nrg1 C A 8: 31,822,306 V388L probably benign Het
Nrg3 T A 14: 39,012,096 T278S probably damaging Het
Numb T C 12: 83,808,216 E112G probably benign Het
Olfr364-ps1 T C 2: 37,146,766 S185P probably damaging Het
Olfr971 A C 9: 39,840,316 N294T probably damaging Het
Pdlim2 C A 14: 70,166,114 C283F probably damaging Het
Ppm1a G A 12: 72,784,135 G145R probably damaging Het
Pramef17 T A 4: 143,994,239 D44V probably benign Het
Prune2 C A 19: 17,125,663 Q2729K probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn9a G T 2: 66,536,282 T719K probably benign Het
Slc12a7 T C 13: 73,785,162 V113A probably benign Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc37a2 A T 9: 37,238,214 probably null Het
Steap1 G A 5: 5,740,816 S44L probably benign Het
Sucnr1 C T 3: 60,086,734 R228C probably damaging Het
Sult3a1 G A 10: 33,866,521 G48D probably damaging Het
Syn3 A T 10: 86,467,027 V88D probably damaging Het
Syne1 T C 10: 5,108,622 D7297G probably benign Het
Tmco5 T C 2: 116,880,253 I18T probably damaging Het
Trpc1 A G 9: 95,726,548 L230P probably damaging Het
Ttn T C 2: 76,889,441 N7108S unknown Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt1a7c T C 1: 88,095,251 V44A possibly damaging Het
Vmn2r60 A T 7: 42,141,070 S494C possibly damaging Het
Other mutations in Klk1b26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Klk1b26 APN 7 44016885 missense probably benign 0.00
IGL02179:Klk1b26 APN 7 44016312 missense probably benign
IGL03190:Klk1b26 APN 7 44012727 missense possibly damaging 0.76
R0391:Klk1b26 UTSW 7 44012727 missense probably damaging 1.00
R0483:Klk1b26 UTSW 7 44016348 missense probably benign 0.15
R1499:Klk1b26 UTSW 7 44016386 missense probably benign 0.22
R1549:Klk1b26 UTSW 7 44016402 splice site probably benign
R1991:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2103:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2998:Klk1b26 UTSW 7 44016798 missense probably benign 0.26
R3414:Klk1b26 UTSW 7 44016873 missense probably benign
R4990:Klk1b26 UTSW 7 44016249 splice site probably null
R4991:Klk1b26 UTSW 7 44016249 splice site probably null
R5527:Klk1b26 UTSW 7 44012763 missense probably benign 0.00
R5796:Klk1b26 UTSW 7 44016328 missense probably damaging 1.00
R6816:Klk1b26 UTSW 7 44016868 missense probably benign 0.00
R6938:Klk1b26 UTSW 7 44016294 missense probably benign 0.00
R7197:Klk1b26 UTSW 7 44016397 critical splice donor site probably null
R7243:Klk1b26 UTSW 7 44016267 missense not run
R7243:Klk1b26 UTSW 7 44016913 missense probably damaging 1.00
R7253:Klk1b26 UTSW 7 44014789 missense possibly damaging 0.66
R7423:Klk1b26 UTSW 7 44014769 missense probably damaging 0.99
R8270:Klk1b26 UTSW 7 44016120 missense probably benign 0.08
Z1088:Klk1b26 UTSW 7 44015996 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCAGCCAGTATGAGGTTTG -3'
(R):5'- TGACTTTTGCCCTGTGGATCAG -3'

Sequencing Primer
(F):5'- TGGCTGGGCAAAAACAAGTTATTCC -3'
(R):5'- CTGTGGATCAGGGAGAAAGTG -3'
Posted On2020-09-02