Incidental Mutation 'R8342:Chst15'
ID 644953
Institutional Source Beutler Lab
Gene Symbol Chst15
Ensembl Gene ENSMUSG00000030930
Gene Name carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
Synonyms MAd5, GalNAcS-6ST, MAd5, 4631426J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R8342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 132235780-132317228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 132247886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 442 (N442S)
Ref Sequence ENSEMBL: ENSMUSP00000076682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077472] [ENSMUST00000080215] [ENSMUST00000124096]
AlphaFold Q91XQ5
Predicted Effect probably benign
Transcript: ENSMUST00000077472
AA Change: N442S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076682
Gene: ENSMUSG00000030930
AA Change: N442S

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 502 4.2e-10 PFAM
Pfam:Sulfotransfer_1 369 524 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080215
AA Change: N442S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000079105
Gene: ENSMUSG00000030930
AA Change: N442S

DomainStartEndE-ValueType
transmembrane domain 80 102 N/A INTRINSIC
Pfam:Sulfotransfer_3 254 499 7.9e-9 PFAM
Pfam:Sulfotransfer_1 369 524 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chondroitin sulfate (CS) is a glycosaminoglycan which is an important structural component of the extracellular matrix and which links to proteins to form proteoglycans. Chondroitin sulfate E (CS-E) is an isomer of chondroitin sulfate in which the C-4 and C-6 hydroxyl groups are sulfated. This gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. This gene has also been identified as being co-expressed with RAG1 in B-cells and as potentially acting as a B-cell surface signaling receptor. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size and abnormal bone marrow-derived mast cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,257,005 probably null Het
Aak1 A G 6: 86,986,339 D917G unknown Het
Adad1 T C 3: 37,079,901 S322P probably damaging Het
Agbl4 C T 4: 111,119,027 L194F probably damaging Het
Ahr C T 12: 35,508,272 G250R probably damaging Het
AI987944 A T 7: 41,374,886 I226N probably benign Het
Ankar A G 1: 72,652,460 V1114A probably damaging Het
Ankrd49 C A 9: 14,781,527 A114S probably damaging Het
Arl6 C T 16: 59,622,439 G140D unknown Het
Arrdc3 A G 13: 80,883,671 S8G probably benign Het
Ate1 A T 7: 130,503,765 V298E probably benign Het
Atp6v1b2 A G 8: 69,101,383 I71V probably benign Het
Bin1 A G 18: 32,413,113 M112V probably benign Het
Camk2b C T 11: 5,990,383 A152T probably benign Het
Cars2 A C 8: 11,529,706 F251V probably damaging Het
Cdkl1 A T 12: 69,754,178 F229I probably damaging Het
Ceacam5 A T 7: 17,752,246 Y556F possibly damaging Het
Ckap5 T A 2: 91,606,362 D1602E possibly damaging Het
Col9a3 A T 2: 180,603,390 I131F unknown Het
Cyp4f15 A T 17: 32,690,759 D110V possibly damaging Het
Dlec1 A G 9: 119,139,389 I1258V probably benign Het
Dpyd A G 3: 119,314,803 T832A possibly damaging Het
Eno1 A G 4: 150,245,236 Y189C probably damaging Het
Gm12800 A T 4: 101,910,384 M277L probably benign Het
Gnat3 A G 5: 18,003,840 T181A Het
Kif1b T C 4: 149,222,348 M852V probably damaging Het
Klk1b26 A T 7: 44,016,084 I139F probably damaging Het
Loxhd1 G A 18: 77,405,985 V1547M possibly damaging Het
Lrp4 A G 2: 91,488,445 T876A probably damaging Het
Malrd1 G T 2: 15,633,224 W451L unknown Het
March6 A T 15: 31,494,116 N261K possibly damaging Het
Mcpt2 T C 14: 56,042,793 C50R probably damaging Het
Muc16 A G 9: 18,658,685 V846A unknown Het
Muc5b A T 7: 141,860,865 D2516V unknown Het
Myh15 T C 16: 49,092,757 L359P probably benign Het
Nemp1 G A 10: 127,693,029 V201I probably benign Het
Nr2e1 A T 10: 42,568,429 L228Q probably damaging Het
Nrg1 C A 8: 31,822,306 V388L probably benign Het
Nrg3 T A 14: 39,012,096 T278S probably damaging Het
Numb T C 12: 83,808,216 E112G probably benign Het
Olfr364-ps1 T C 2: 37,146,766 S185P probably damaging Het
Olfr971 A C 9: 39,840,316 N294T probably damaging Het
Pdlim2 C A 14: 70,166,114 C283F probably damaging Het
Ppm1a G A 12: 72,784,135 G145R probably damaging Het
Pramef17 T A 4: 143,994,239 D44V probably benign Het
Prune2 C A 19: 17,125,663 Q2729K probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn9a G T 2: 66,536,282 T719K probably benign Het
Slc12a7 T C 13: 73,785,162 V113A probably benign Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc37a2 A T 9: 37,238,214 probably null Het
Steap1 G A 5: 5,740,816 S44L probably benign Het
Sucnr1 C T 3: 60,086,734 R228C probably damaging Het
Sult3a1 G A 10: 33,866,521 G48D probably damaging Het
Syn3 A T 10: 86,467,027 V88D probably damaging Het
Syne1 T C 10: 5,108,622 D7297G probably benign Het
Tmco5 T C 2: 116,880,253 I18T probably damaging Het
Trpc1 A G 9: 95,726,548 L230P probably damaging Het
Ttn T C 2: 76,889,441 N7108S unknown Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt1a7c T C 1: 88,095,251 V44A possibly damaging Het
Vmn2r60 A T 7: 42,141,070 S494C possibly damaging Het
Other mutations in Chst15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Chst15 APN 7 132270507 missense probably benign 0.22
IGL01879:Chst15 APN 7 132270265 missense possibly damaging 0.94
IGL02355:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02362:Chst15 APN 7 132266672 missense probably benign 0.26
IGL02826:Chst15 APN 7 132266746 missense probably damaging 1.00
IGL02860:Chst15 APN 7 132269102 missense probably benign
IGL02972:Chst15 APN 7 132269173 missense probably damaging 1.00
IGL03266:Chst15 APN 7 132270076 missense probably damaging 1.00
IGL03331:Chst15 APN 7 132262713 missense probably damaging 1.00
IGL03375:Chst15 APN 7 132270457 nonsense probably null
R1476:Chst15 UTSW 7 132270273 missense possibly damaging 0.95
R1501:Chst15 UTSW 7 132269069 nonsense probably null
R1518:Chst15 UTSW 7 132270126 missense probably damaging 1.00
R1943:Chst15 UTSW 7 132262850 splice site probably null
R2164:Chst15 UTSW 7 132270385 missense probably damaging 0.97
R3947:Chst15 UTSW 7 132247875 missense probably damaging 1.00
R4921:Chst15 UTSW 7 132247884 missense probably benign 0.01
R5817:Chst15 UTSW 7 132269144 missense probably damaging 0.99
R5817:Chst15 UTSW 7 132269147 missense probably damaging 0.99
R5917:Chst15 UTSW 7 132270517 missense probably benign
R6930:Chst15 UTSW 7 132269030 missense possibly damaging 0.95
R7159:Chst15 UTSW 7 132270258 missense probably damaging 1.00
R7911:Chst15 UTSW 7 132270522 missense probably benign 0.12
R8282:Chst15 UTSW 7 132270150 missense probably benign
R9011:Chst15 UTSW 7 132270517 missense probably benign
R9093:Chst15 UTSW 7 132268917 critical splice donor site probably null
R9329:Chst15 UTSW 7 132266791 missense possibly damaging 0.46
R9352:Chst15 UTSW 7 132270528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGTCATTTGCACATTCAAAC -3'
(R):5'- ACCAGCTAATGTAATGGCTAGCC -3'

Sequencing Primer
(F):5'- GTCATTTGCACATTCAAACACTCCG -3'
(R):5'- GTTTCACACCCTCGGATGGTAAG -3'
Posted On 2020-09-02