Incidental Mutation 'R8342:Nr2e1'
ID 644966
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Name nuclear receptor subfamily 2, group E, member 1
Synonyms tailless, Mtll, Tlx, Nr2e1
MMRRC Submission 067731-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # R8342 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 42437959-42459628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42444425 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 228 (L228Q)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105498]
AlphaFold Q64104
Predicted Effect probably damaging
Transcript: ENSMUST00000019938
AA Change: L228Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: L228Q

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105498
AA Change: L16Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101137
Gene: ENSMUSG00000019803
AA Change: L16Q

DomainStartEndE-ValueType
HOLI 3 142 2.56e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A G 6: 86,963,321 (GRCm39) D917G unknown Het
Adad1 T C 3: 37,134,050 (GRCm39) S322P probably damaging Het
Agbl4 C T 4: 110,976,224 (GRCm39) L194F probably damaging Het
Ahr C T 12: 35,558,271 (GRCm39) G250R probably damaging Het
AI987944 A T 7: 41,024,310 (GRCm39) I226N probably benign Het
Ankar A G 1: 72,691,619 (GRCm39) V1114A probably damaging Het
Ankrd49 C A 9: 14,692,823 (GRCm39) A114S probably damaging Het
Arl6 C T 16: 59,442,802 (GRCm39) G140D unknown Het
Arrdc3 A G 13: 81,031,790 (GRCm39) S8G probably benign Het
Ate1 A T 7: 130,105,495 (GRCm39) V298E probably benign Het
Atp6v1b2 A G 8: 69,554,035 (GRCm39) I71V probably benign Het
Bin1 A G 18: 32,546,166 (GRCm39) M112V probably benign Het
Camk2b C T 11: 5,940,383 (GRCm39) A152T probably benign Het
Cars2 A C 8: 11,579,706 (GRCm39) F251V probably damaging Het
Cdkl1 A T 12: 69,800,952 (GRCm39) F229I probably damaging Het
Ceacam5 A T 7: 17,486,171 (GRCm39) Y556F possibly damaging Het
Chst15 T C 7: 131,849,615 (GRCm39) N442S probably benign Het
Ckap5 T A 2: 91,436,707 (GRCm39) D1602E possibly damaging Het
Col9a3 A T 2: 180,245,183 (GRCm39) I131F unknown Het
Cyp4f15 A T 17: 32,909,733 (GRCm39) D110V possibly damaging Het
Dlec1 A G 9: 118,968,457 (GRCm39) I1258V probably benign Het
Dpyd A G 3: 119,108,452 (GRCm39) T832A possibly damaging Het
Eno1 A G 4: 150,329,693 (GRCm39) Y189C probably damaging Het
Gnat3 A G 5: 18,208,838 (GRCm39) T181A Het
Kif1b T C 4: 149,306,805 (GRCm39) M852V probably damaging Het
Klk1b26 A T 7: 43,665,508 (GRCm39) I139F probably damaging Het
Loxhd1 G A 18: 77,493,681 (GRCm39) V1547M possibly damaging Het
Lrp4 A G 2: 91,318,790 (GRCm39) T876A probably damaging Het
Malrd1 G T 2: 15,638,035 (GRCm39) W451L unknown Het
Marchf6 A T 15: 31,494,262 (GRCm39) N261K possibly damaging Het
Mcpt2 T C 14: 56,280,250 (GRCm39) C50R probably damaging Het
Muc16 A G 9: 18,569,981 (GRCm39) V846A unknown Het
Muc5b A T 7: 141,414,602 (GRCm39) D2516V unknown Het
Myh15 T C 16: 48,913,120 (GRCm39) L359P probably benign Het
Nemp1 G A 10: 127,528,898 (GRCm39) V201I probably benign Het
Nrg1 C A 8: 32,312,334 (GRCm39) V388L probably benign Het
Nrg3 T A 14: 38,734,053 (GRCm39) T278S probably damaging Het
Numb T C 12: 83,854,990 (GRCm39) E112G probably benign Het
Or1l4b T C 2: 37,036,778 (GRCm39) S185P probably damaging Het
Or8g2b A C 9: 39,751,612 (GRCm39) N294T probably damaging Het
Pdlim2 C A 14: 70,403,563 (GRCm39) C283F probably damaging Het
Potegl T A 2: 23,147,017 (GRCm39) probably null Het
Ppm1a G A 12: 72,830,909 (GRCm39) G145R probably damaging Het
Pramel14 T A 4: 143,720,809 (GRCm39) D44V probably benign Het
Pramel18 A T 4: 101,767,581 (GRCm39) M277L probably benign Het
Prune2 C A 19: 17,103,027 (GRCm39) Q2729K probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Scn9a G T 2: 66,366,626 (GRCm39) T719K probably benign Het
Slc12a7 T C 13: 73,933,281 (GRCm39) V113A probably benign Het
Slc23a1 C T 18: 35,755,588 (GRCm39) G436E probably damaging Het
Slc37a2 A T 9: 37,149,510 (GRCm39) probably null Het
Steap1 G A 5: 5,790,816 (GRCm39) S44L probably benign Het
Sucnr1 C T 3: 59,994,155 (GRCm39) R228C probably damaging Het
Sult3a1 G A 10: 33,742,517 (GRCm39) G48D probably damaging Het
Syn3 A T 10: 86,302,891 (GRCm39) V88D probably damaging Het
Syne1 T C 10: 5,058,622 (GRCm39) D7297G probably benign Het
Tmco5 T C 2: 116,710,734 (GRCm39) I18T probably damaging Het
Trpc1 A G 9: 95,608,601 (GRCm39) L230P probably damaging Het
Ttn T C 2: 76,719,785 (GRCm39) N7108S unknown Het
Ubr5 A G 15: 38,025,081 (GRCm39) V559A Het
Ugt1a7c T C 1: 88,022,973 (GRCm39) V44A possibly damaging Het
Vmn2r60 A T 7: 41,790,494 (GRCm39) S494C possibly damaging Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42,444,449 (GRCm39) missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42,443,969 (GRCm39) missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42,443,975 (GRCm39) missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42,447,478 (GRCm39) missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42,444,377 (GRCm39) missense probably damaging 1.00
Dubious UTSW 10 42,447,483 (GRCm39) nonsense probably null
BB010:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42,443,964 (GRCm39) missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42,458,905 (GRCm39) splice site probably null
R1879:Nr2e1 UTSW 10 42,444,367 (GRCm39) critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42,448,774 (GRCm39) missense probably benign
R2426:Nr2e1 UTSW 10 42,439,481 (GRCm39) missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42,444,441 (GRCm39) missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42,454,187 (GRCm39) missense probably benign
R5305:Nr2e1 UTSW 10 42,447,483 (GRCm39) nonsense probably null
R5316:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42,448,780 (GRCm39) missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42,448,765 (GRCm39) missense probably benign
R7040:Nr2e1 UTSW 10 42,444,374 (GRCm39) missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42,439,475 (GRCm39) missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42,450,433 (GRCm39) missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42,439,379 (GRCm39) missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42,458,881 (GRCm39) missense probably benign 0.00
R8916:Nr2e1 UTSW 10 42,443,864 (GRCm39) missense possibly damaging 0.94
R9145:Nr2e1 UTSW 10 42,448,948 (GRCm39) missense probably benign 0.02
R9189:Nr2e1 UTSW 10 42,454,268 (GRCm39) missense probably damaging 0.99
R9381:Nr2e1 UTSW 10 42,439,468 (GRCm39) missense probably damaging 1.00
R9499:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
R9552:Nr2e1 UTSW 10 42,447,487 (GRCm39) missense probably benign 0.10
Z1177:Nr2e1 UTSW 10 42,444,423 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACTCTATTGTTCCGCGGG -3'
(R):5'- CTGACTCTGAAATGCCTGTGTG -3'

Sequencing Primer
(F):5'- CCGCGGGAATTTGTTATTCTTTAC -3'
(R):5'- CACTTTAACGGAAATTTACATATGG -3'
Posted On 2020-09-02