Incidental Mutation 'R8342:Nr2e1'
ID644966
Institutional Source Beutler Lab
Gene Symbol Nr2e1
Ensembl Gene ENSMUSG00000019803
Gene Namenuclear receptor subfamily 2, group E, member 1
SynonymsMtll, Tlx, tailless, Nr2e1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R8342 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location42561963-42583632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42568429 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 228 (L228Q)
Ref Sequence ENSEMBL: ENSMUSP00000019938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019938] [ENSMUST00000105498]
Predicted Effect probably damaging
Transcript: ENSMUST00000019938
AA Change: L228Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019938
Gene: ENSMUSG00000019803
AA Change: L228Q

DomainStartEndE-ValueType
ZnF_C4 13 86 2.04e-36 SMART
HOLI 187 354 1.42e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105498
AA Change: L16Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101137
Gene: ENSMUSG00000019803
AA Change: L16Q

DomainStartEndE-ValueType
HOLI 3 142 2.56e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan receptor involved in retinal development. The encoded protein also regulates adult neural stem cell proliferation and may be involved in control of aggressive behavior. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes have small brains, hypoplasia of cerebrum and olfactory lobes, thin optic layers, reduced retinal vessels and hydrocephaly on some genetic backgrounds. Mutants do poorly in sensorimotor tests, are aggressive and females lack maternal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T A 2: 23,257,005 probably null Het
Aak1 A G 6: 86,986,339 D917G unknown Het
Adad1 T C 3: 37,079,901 S322P probably damaging Het
Agbl4 C T 4: 111,119,027 L194F probably damaging Het
Ahr C T 12: 35,508,272 G250R probably damaging Het
AI987944 A T 7: 41,374,886 I226N probably benign Het
Ankar A G 1: 72,652,460 V1114A probably damaging Het
Ankrd49 C A 9: 14,781,527 A114S probably damaging Het
Arl6 C T 16: 59,622,439 G140D unknown Het
Arrdc3 A G 13: 80,883,671 S8G probably benign Het
Ate1 A T 7: 130,503,765 V298E probably benign Het
Atp6v1b2 A G 8: 69,101,383 I71V probably benign Het
Bin1 A G 18: 32,413,113 M112V probably benign Het
Camk2b C T 11: 5,990,383 A152T probably benign Het
Cars2 A C 8: 11,529,706 F251V probably damaging Het
Cdkl1 A T 12: 69,754,178 F229I probably damaging Het
Ceacam5 A T 7: 17,752,246 Y556F possibly damaging Het
Chst15 T C 7: 132,247,886 N442S probably benign Het
Ckap5 T A 2: 91,606,362 D1602E possibly damaging Het
Col9a3 A T 2: 180,603,390 I131F unknown Het
Cyp4f15 A T 17: 32,690,759 D110V possibly damaging Het
Dlec1 A G 9: 119,139,389 I1258V probably benign Het
Dpyd A G 3: 119,314,803 T832A possibly damaging Het
Eno1 A G 4: 150,245,236 Y189C probably damaging Het
Gm12800 A T 4: 101,910,384 M277L probably benign Het
Gnat3 A G 5: 18,003,840 T181A Het
Kif1b T C 4: 149,222,348 M852V probably damaging Het
Klk1b26 A T 7: 44,016,084 I139F probably damaging Het
Loxhd1 G A 18: 77,405,985 V1547M possibly damaging Het
Lrp4 A G 2: 91,488,445 T876A probably damaging Het
Malrd1 G T 2: 15,633,224 W451L unknown Het
March6 A T 15: 31,494,116 N261K possibly damaging Het
Mcpt2 T C 14: 56,042,793 C50R probably damaging Het
Muc16 A G 9: 18,658,685 V846A unknown Het
Muc5b A T 7: 141,860,865 D2516V unknown Het
Myh15 T C 16: 49,092,757 L359P probably benign Het
Nemp1 G A 10: 127,693,029 V201I probably benign Het
Nrg1 C A 8: 31,822,306 V388L probably benign Het
Nrg3 T A 14: 39,012,096 T278S probably damaging Het
Numb T C 12: 83,808,216 E112G probably benign Het
Olfr364-ps1 T C 2: 37,146,766 S185P probably damaging Het
Olfr971 A C 9: 39,840,316 N294T probably damaging Het
Pdlim2 C A 14: 70,166,114 C283F probably damaging Het
Ppm1a G A 12: 72,784,135 G145R probably damaging Het
Pramef17 T A 4: 143,994,239 D44V probably benign Het
Prune2 C A 19: 17,125,663 Q2729K probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Scn9a G T 2: 66,536,282 T719K probably benign Het
Slc12a7 T C 13: 73,785,162 V113A probably benign Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc37a2 A T 9: 37,238,214 probably null Het
Steap1 G A 5: 5,740,816 S44L probably benign Het
Sucnr1 C T 3: 60,086,734 R228C probably damaging Het
Sult3a1 G A 10: 33,866,521 G48D probably damaging Het
Syn3 A T 10: 86,467,027 V88D probably damaging Het
Syne1 T C 10: 5,108,622 D7297G probably benign Het
Tmco5 T C 2: 116,880,253 I18T probably damaging Het
Trpc1 A G 9: 95,726,548 L230P probably damaging Het
Ttn T C 2: 76,889,441 N7108S unknown Het
Ubr5 A G 15: 38,024,837 V559A Het
Ugt1a7c T C 1: 88,095,251 V44A possibly damaging Het
Vmn2r60 A T 7: 42,141,070 S494C possibly damaging Het
Other mutations in Nr2e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nr2e1 APN 10 42568453 missense probably damaging 1.00
IGL01936:Nr2e1 APN 10 42567973 missense possibly damaging 0.90
IGL02272:Nr2e1 APN 10 42567979 missense probably damaging 1.00
IGL03092:Nr2e1 APN 10 42571482 missense probably damaging 1.00
IGL03405:Nr2e1 APN 10 42568381 missense probably damaging 1.00
Dubious UTSW 10 42571487 nonsense probably null
BB010:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
BB020:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R1581:Nr2e1 UTSW 10 42567968 missense probably benign 0.12
R1807:Nr2e1 UTSW 10 42582909 splice site probably null
R1879:Nr2e1 UTSW 10 42568371 critical splice donor site probably null
R1944:Nr2e1 UTSW 10 42572778 missense probably benign
R2426:Nr2e1 UTSW 10 42563485 missense probably damaging 1.00
R2842:Nr2e1 UTSW 10 42568445 missense probably damaging 0.99
R4515:Nr2e1 UTSW 10 42578191 missense probably benign
R5305:Nr2e1 UTSW 10 42571487 nonsense probably null
R5316:Nr2e1 UTSW 10 42571491 missense probably benign 0.10
R5325:Nr2e1 UTSW 10 42572784 missense probably damaging 1.00
R5908:Nr2e1 UTSW 10 42572769 missense probably benign
R7040:Nr2e1 UTSW 10 42568378 missense probably damaging 0.99
R7593:Nr2e1 UTSW 10 42563479 missense probably damaging 1.00
R7765:Nr2e1 UTSW 10 42574437 missense probably benign 0.32
R7933:Nr2e1 UTSW 10 42563383 missense probably damaging 1.00
R8158:Nr2e1 UTSW 10 42582885 missense probably benign 0.00
Z1177:Nr2e1 UTSW 10 42568427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACTCTATTGTTCCGCGGG -3'
(R):5'- CTGACTCTGAAATGCCTGTGTG -3'

Sequencing Primer
(F):5'- CCGCGGGAATTTGTTATTCTTTAC -3'
(R):5'- CACTTTAACGGAAATTTACATATGG -3'
Posted On2020-09-02