Incidental Mutation 'R8343:Mettl18'
ID644989
Institutional Source Beutler Lab
Gene Symbol Mettl18
Ensembl Gene ENSMUSG00000041396
Gene Namemethyltransferase like 18
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R8343 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location163994889-163997243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 163996940 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 277 (Y277N)
Ref Sequence ENSEMBL: ENSMUSP00000048636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045694] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000111490] [ENSMUST00000160926]
Predicted Effect probably damaging
Transcript: ENSMUST00000045694
AA Change: Y277N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048636
Gene: ENSMUSG00000041396
AA Change: Y277N

DomainStartEndE-ValueType
Pfam:Methyltransf_16 150 233 7.3e-7 PFAM
Pfam:PrmA 166 240 2.1e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111490
AA Change: Y277N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107116
Gene: ENSMUSG00000041396
AA Change: Y277N

DomainStartEndE-ValueType
Pfam:MTS 147 232 4.5e-6 PFAM
Pfam:Methyltransf_16 149 233 3.6e-7 PFAM
Pfam:PrmA 166 238 2.7e-7 PFAM
low complexity region 300 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160926
SMART Domains Protein: ENSMUSP00000124826
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,729 W156R probably damaging Het
Acvr1 T A 2: 58,474,274 probably null Het
Adamts2 G T 11: 50,603,488 V130L probably damaging Het
Adcy4 C T 14: 55,775,240 V541I probably benign Het
Adgrl2 C T 3: 148,846,906 V654I probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 A T 14: 78,512,489 S819R Het
Alox5ap T C 5: 149,287,609 F121L probably damaging Het
Baz2b A T 2: 59,901,514 M2060K probably damaging Het
C030005K15Rik T C 10: 97,725,552 I106V unknown Het
Carmil2 T A 8: 105,691,084 S604T probably benign Het
Cdhr1 T C 14: 37,091,978 T164A probably benign Het
Dhx30 T C 9: 110,085,501 E976G possibly damaging Het
Dnah17 C T 11: 118,114,195 G788R probably benign Het
Dus2 T C 8: 105,996,013 probably benign Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Fabp9 T G 3: 10,194,025 K107T possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gapdh A G 6: 125,163,263 V92A probably benign Het
Gfy A G 7: 45,176,595 L453P probably damaging Het
Gm6588 C T 5: 112,450,787 T400I probably benign Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gtpbp8 T C 16: 44,746,313 R9G probably benign Het
Hipk4 G T 7: 27,523,608 R31L probably damaging Het
Htt T A 5: 34,905,724 M2900K probably damaging Het
Ighv1-20 T C 12: 114,724,190 I6V probably benign Het
Il17d C T 14: 57,542,480 T153I probably damaging Het
Izumo3 T A 4: 92,146,344 N117I probably damaging Het
Kcnh7 T C 2: 62,850,535 D236G probably benign Het
Kmt2d T C 15: 98,852,597 D2405G unknown Het
Map4k2 T C 19: 6,346,566 W533R probably damaging Het
Matn1 C A 4: 130,945,989 Y89* probably null Het
Muc5b G A 7: 141,864,161 G3615S probably benign Het
Myh4 T A 11: 67,252,564 S1041T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naaladl1 T C 19: 6,109,673 V378A possibly damaging Het
Nars T C 18: 64,504,387 D374G probably benign Het
Neurl1b A G 17: 26,431,991 Y79C probably damaging Het
Nynrin A G 14: 55,863,791 T306A probably benign Het
Ola1 G T 2: 73,199,401 R125S probably damaging Het
Olfr105-ps T A 17: 37,383,231 F221L probably benign Het
Olfr644 A T 7: 104,068,176 V285D probably damaging Het
Pak1ip1 C A 13: 41,004,738 T29K probably benign Het
Podnl1 T A 8: 84,130,773 L337H Het
Rictor T G 15: 6,778,319 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sel1l2 T C 2: 140,230,833 I627M probably benign Het
Sh3rf2 T C 18: 42,111,428 S352P probably damaging Het
Slc6a6 G A 6: 91,726,243 W199* probably null Het
Smc2 T A 4: 52,450,965 V261E probably benign Het
Spdye4a T A 5: 143,225,807 M1L probably benign Het
Stag1 T C 9: 100,757,766 I125T possibly damaging Het
Stx8 T A 11: 68,020,988 D177E probably benign Het
Sun2 T C 15: 79,738,924 Y71C probably damaging Het
Tmed9 T C 13: 55,594,804 F129L probably benign Het
Tmem216 T A 19: 10,551,972 T17S probably benign Het
Tmpo A T 10: 91,162,112 N604K probably benign Het
Tmprss11f T A 5: 86,533,807 I196F probably benign Het
Tnks A G 8: 34,834,584 F1244L probably benign Het
Tspan2 T C 3: 102,768,910 C212R probably damaging Het
Tspan4 A G 7: 141,491,805 D155G probably damaging Het
Ttc6 T C 12: 57,660,496 F730L possibly damaging Het
Txnrd2 G A 16: 18,426,541 A33T unknown Het
Uhrf1bp1l T C 10: 89,791,419 S449P probably benign Het
Wnk1 C T 6: 119,963,493 R761H probably damaging Het
Zfp217 T C 2: 170,120,104 D101G probably damaging Het
Zfp281 T C 1: 136,627,882 F866S probably damaging Het
Other mutations in Mettl18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Mettl18 APN 1 163996226 missense possibly damaging 0.83
IGL01989:Mettl18 APN 1 163996303 missense probably benign 0.00
R0190:Mettl18 UTSW 1 163996422 missense probably damaging 0.98
R0394:Mettl18 UTSW 1 163996341 missense probably benign
R0562:Mettl18 UTSW 1 163996493 missense probably benign 0.04
R2260:Mettl18 UTSW 1 163996825 missense probably benign 0.28
R4293:Mettl18 UTSW 1 163996602 missense probably damaging 1.00
R4626:Mettl18 UTSW 1 163996476 missense probably damaging 1.00
R4749:Mettl18 UTSW 1 163996785 missense probably benign 0.13
R5930:Mettl18 UTSW 1 163997177 missense probably null 0.00
R5987:Mettl18 UTSW 1 163996775 missense probably benign 0.04
R6503:Mettl18 UTSW 1 163997118 missense possibly damaging 0.94
R6687:Mettl18 UTSW 1 163996800 missense possibly damaging 0.73
R6730:Mettl18 UTSW 1 163997181 missense probably damaging 1.00
R7457:Mettl18 UTSW 1 163996761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACGGTTTGGTGATCGATG -3'
(R):5'- GTGTTCGAGTCTCAAATACACCC -3'

Sequencing Primer
(F):5'- GATCGATGAGGTGACCTTACC -3'
(R):5'- CGAGTCTCAAATACACCCTTTTC -3'
Posted On2020-09-02