Mutagenetix > Incidental Mutations

Incidental Mutation 'R0026:Ibtk'

64500

Institutional Source

Beutler Lab

Gene Symbol

Ibtk

Ensembl Gene

ENSMUSG00000035941

Gene Name

inhibitor of Bruton agammaglobulinemia tyrosine kinase

Synonyms

5430411K16Rik

MMRRC Submission

038321-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0026 (G1)

Quality Score

130

Status

Validated

Chromosome

Chromosomal Location

85687360-85749334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85690303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1278 (V1278A)

Ref Sequence

ENSEMBL: ENSMUSP00000041145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]

AlphaFold

Q6ZPR6

Predicted Effect

probably benign
Transcript: ENSMUST00000039213
AA Change: V1278A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941
AA Change: V1278A

Domain	Start	End	E-Value	Type
ANK	51	80	2e0	SMART
ANK	85	114	2.58e-3	SMART
Pfam:RCC1	143	192	8.1e-10	PFAM
Pfam:RCC1	195	244	1.1e-14	PFAM
Pfam:RCC1	247	299	5.3e-13	PFAM
low complexity region	307	318	N/A	INTRINSIC
low complexity region	543	551	N/A	INTRINSIC
BTB	565	745	5.48e-13	SMART
BTB	769	872	4.09e-12	SMART
low complexity region	977	990	N/A	INTRINSIC
low complexity region	1269	1281	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186322

Predicted Effect

probably benign
Transcript: ENSMUST00000187521

SMART Domains

Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941

Domain	Start	End	E-Value	Type
ANK	51	80	1.3e-2	SMART
ANK	85	114	1.7e-5	SMART
Pfam:RCC1	143	192	1.9e-8	PFAM
Pfam:RCC1	195	244	1.4e-12	PFAM
Pfam:RCC1	247	299	2.7e-10	PFAM
low complexity region	307	318	N/A	INTRINSIC

Meta Mutation Damage Score

0.0630

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.8%
20x: 96.3%

Validation Efficiency

93% (70/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,066,805	I585N	possibly damaging	Het
4931408C20Rik	T	A	1: 26,683,369	D910V	probably benign	Het
A830005F24Rik	C	T	13: 48,514,372		probably benign	Het
Abca16	C	T	7: 120,477,923		probably benign	Het
Acot10	G	A	15: 20,666,236	L140F	probably benign	Het
Adam19	G	T	11: 46,136,259	C573F	probably damaging	Het
Aff3	A	G	1: 38,203,893	S948P	probably benign	Het
Anxa3	T	A	5: 96,838,401	Y300N	probably benign	Het
BC016579	T	C	16: 45,640,367	T113A	probably benign	Het
Bmpr1b	A	G	3: 141,870,733	L113P	probably benign	Het
Casq1	T	C	1: 172,219,400		probably benign	Het
Cdc16	T	A	8: 13,759,130		probably null	Het
Cep135	C	T	5: 76,606,734	R353*	probably null	Het
Cma1	A	T	14: 55,942,164	C188S	probably damaging	Het
Csf3r	A	G	4: 126,031,884	T151A	probably benign	Het
Cyp4b1	C	T	4: 115,647,521	G56D	possibly damaging	Het
Dbn1	T	C	13: 55,477,784	E275G	probably damaging	Het
Dlgap2	C	T	8: 14,727,363	Q203*	probably null	Het
Ephb3	A	G	16: 21,214,917	D251G	probably damaging	Het
Fancd2os	G	T	6: 113,597,691	T118N	probably damaging	Het
Gm10801	T	C	2: 98,663,909		probably benign	Het
Got1l1	C	T	8: 27,200,248	V132I	probably benign	Het
H2-M9	T	C	17: 36,641,527		probably benign	Het
Kctd3	T	C	1: 188,976,621	T519A	probably damaging	Het
Lgsn	T	A	1: 31,203,443	V202D	probably damaging	Het
Madd	A	G	2: 91,175,708	F381L	possibly damaging	Het
Map1s	G	A	8: 70,914,638	G729D	probably damaging	Het
Mlycd	A	G	8: 119,410,435	I465V	probably benign	Het
Mrgprb1	T	C	7: 48,447,204	R108G	possibly damaging	Het
Mrgprx2	T	A	7: 48,482,023	H106L	possibly damaging	Het
Ncor1	T	C	11: 62,438,429	Y6C	probably damaging	Het
Nfkb1	T	C	3: 135,591,573	D773G	probably damaging	Het
Nxnl1	A	G	8: 71,566,573	S3P	probably damaging	Het
Olfr109	T	A	17: 37,466,803	V199D	probably damaging	Het
Olfr921	G	A	9: 38,775,596	V114I	probably benign	Het
Otud7a	T	C	7: 63,735,801	F338L	probably benign	Het
Pdcl3	T	A	1: 38,991,280	L14Q	probably damaging	Het
Pla2g7	T	A	17: 43,594,930		probably benign	Het
Prpf31	T	A	7: 3,639,668	N413K	probably benign	Het
Rapgef5	T	C	12: 117,689,161	S307P	probably benign	Het
Relt	C	A	7: 100,850,221	E164*	probably null	Het
Rnf185	T	C	11: 3,426,617	D86G	probably damaging	Het
Rrm2b	T	C	15: 37,953,741	E21G	probably benign	Het
Scn5a	A	G	9: 119,522,566	I783T	probably damaging	Het
Senp1	T	C	15: 98,076,668	R88G	probably damaging	Het
Skint5	A	T	4: 113,546,468		probably benign	Het
Slc35b1	T	C	11: 95,390,642	S294P	probably benign	Het
Slc5a2	T	A	7: 128,270,053	I335N	probably damaging	Het
Sstr1	T	A	12: 58,212,858	M89K	probably damaging	Het
Szt2	A	T	4: 118,384,772	S1612R	possibly damaging	Het
Taf1c	T	C	8: 119,604,236		probably null	Het
Taf1d	T	A	9: 15,308,648	S64R	probably damaging	Het
Tmem125	A	G	4: 118,542,073	S54P	possibly damaging	Het
Ttf1	T	A	2: 29,071,349	I583N	possibly damaging	Het
Uchl4	A	T	9: 64,235,371		probably null	Het
Unc5b	A	T	10: 60,774,592	I482N	possibly damaging	Het
Unc80	C	A	1: 66,521,584	Q824K	probably benign	Het
Utrn	T	C	10: 12,726,196		probably benign	Het
Vmn2r61	T	G	7: 42,275,474	I484R	possibly damaging	Het
Vps13b	T	C	15: 35,923,301	I3774T	possibly damaging	Het
Yipf1	T	A	4: 107,345,160	L240*	probably null	Het

Other mutations in Ibtk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ibtk	APN	9	85717545	splice site	probably null
IGL00852:Ibtk	APN	9	85713601	missense	probably benign	0.01
IGL00907:Ibtk	APN	9	85690331	missense	possibly damaging	0.51
IGL01101:Ibtk	APN	9	85732622	splice site	probably benign
IGL02125:Ibtk	APN	9	85735070	missense	probably damaging	1.00
IGL02214:Ibtk	APN	9	85714179	splice site	probably benign
IGL02223:Ibtk	APN	9	85710366	splice site	probably benign
IGL02638:Ibtk	APN	9	85719893	missense	probably damaging	1.00
IGL02741:Ibtk	APN	9	85726612	missense	probably damaging	1.00
IGL03299:Ibtk	APN	9	85721136	missense	probably benign	0.27
IGL03493:Ibtk	APN	9	85718919	missense	probably benign	0.44
Biddie	UTSW	9	85697237	missense	possibly damaging	0.87
R0026:Ibtk	UTSW	9	85690303	missense	probably benign
R0558:Ibtk	UTSW	9	85737538	missense	probably damaging	0.99
R0569:Ibtk	UTSW	9	85708181	splice site	probably benign
R0932:Ibtk	UTSW	9	85735046	missense	probably damaging	1.00
R0973:Ibtk	UTSW	9	85743577	missense	probably damaging	1.00
R1237:Ibtk	UTSW	9	85720748	missense	probably benign	0.00
R1245:Ibtk	UTSW	9	85720742	critical splice donor site	probably null
R1462:Ibtk	UTSW	9	85724145	missense	probably damaging	0.99
R1462:Ibtk	UTSW	9	85724145	missense	probably damaging	0.99
R1921:Ibtk	UTSW	9	85703082	missense	probably benign
R2090:Ibtk	UTSW	9	85720993	missense	probably benign	0.01
R2109:Ibtk	UTSW	9	85706550	missense	probably benign
R2277:Ibtk	UTSW	9	85703151	missense	probably benign
R2437:Ibtk	UTSW	9	85708125	missense	probably benign	0.27
R2446:Ibtk	UTSW	9	85703073	missense	probably benign	0.22
R3107:Ibtk	UTSW	9	85710414	missense	probably damaging	1.00
R3876:Ibtk	UTSW	9	85718426	missense	probably benign	0.06
R4160:Ibtk	UTSW	9	85703090	missense	probably benign	0.01
R4273:Ibtk	UTSW	9	85726731	missense	probably damaging	1.00
R4321:Ibtk	UTSW	9	85735072	missense	possibly damaging	0.49
R4827:Ibtk	UTSW	9	85728554	missense	probably benign	0.04
R4947:Ibtk	UTSW	9	85710412	missense	probably benign	0.00
R5228:Ibtk	UTSW	9	85726689	missense	possibly damaging	0.58
R5268:Ibtk	UTSW	9	85743690	missense	probably benign	0.00
R5327:Ibtk	UTSW	9	85737466	critical splice donor site	probably null
R5344:Ibtk	UTSW	9	85735004	missense	possibly damaging	0.90
R5414:Ibtk	UTSW	9	85726689	missense	possibly damaging	0.58
R5502:Ibtk	UTSW	9	85720863	missense	probably benign	0.13
R5756:Ibtk	UTSW	9	85731254	missense	possibly damaging	0.51
R7144:Ibtk	UTSW	9	85743691	missense	probably benign	0.03
R7196:Ibtk	UTSW	9	85743656	missense	probably damaging	1.00
R7490:Ibtk	UTSW	9	85718934	critical splice acceptor site	probably null
R7571:Ibtk	UTSW	9	85722300	missense	probably benign
R7757:Ibtk	UTSW	9	85697237	missense	possibly damaging	0.87
R8007:Ibtk	UTSW	9	85690717	missense	probably benign	0.09
R8065:Ibtk	UTSW	9	85720863	missense	probably benign	0.13
R8407:Ibtk	UTSW	9	85721066	missense	possibly damaging	0.93
R8711:Ibtk	UTSW	9	85724155	missense	probably benign
R8753:Ibtk	UTSW	9	85728766	missense	probably benign	0.01
R8835:Ibtk	UTSW	9	85737510	missense	possibly damaging	0.50
R8906:Ibtk	UTSW	9	85743404	missense	possibly damaging	0.91
R8980:Ibtk	UTSW	9	85732730	nonsense	probably null
R9140:Ibtk	UTSW	9	85735061	missense	probably damaging	1.00
R9230:Ibtk	UTSW	9	85703649	critical splice donor site	probably null
R9406:Ibtk	UTSW	9	85721340	nonsense	probably null
X0021:Ibtk	UTSW	9	85697174	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- AGACCCAGAGTTGAAATGTACCACAGT -3'
(R):5'- GCACACGGTAATTTGTCTCCTGAGTC -3'

Sequencing Primer
(F):5'- TACCACAGTTCTCAGTGCGAG -3'
(R):5'- CAAGTGAAATGATGGTTCTCCC -3'

Posted On

2013-08-06