Incidental Mutation 'R8343:Etv6'
ID 645013
Institutional Source Beutler Lab
Gene Symbol Etv6
Ensembl Gene ENSMUSG00000030199
Gene Name ets variant 6
Synonyms translocation-ets-leukemia, Tel
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007961.3; MGI: 109336

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8343 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 134035700-134270158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 134248754 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 316 (V316A)
Ref Sequence ENSEMBL: ENSMUSP00000079818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081028] [ENSMUST00000111963] [ENSMUST00000164648]
AlphaFold P97360
PDB Structure Intramolecular regulation of the ETS Domain within ETV6 sequence R335 to Q436 [SOLUTION NMR]
Intramolecular regulation of the ETS Domain within ETV6 sequence R335 to R458 [SOLUTION NMR]
Structure of uninhibited ETV6 ETS domain [SOLUTION NMR]
Crystal structure of ETV6 bound to a specific DNA sequence [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081028
AA Change: V316A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079818
Gene: ENSMUSG00000030199
AA Change: V316A

DomainStartEndE-ValueType
SAM_PNT 39 125 3.49e-41 SMART
ETS 334 420 7.02e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111963
AA Change: V227A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107594
Gene: ENSMUSG00000030199
AA Change: V227A

DomainStartEndE-ValueType
Pfam:SAM_PNT 1 36 1.3e-10 PFAM
ETS 245 331 7.02e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145869
Predicted Effect probably benign
Transcript: ENSMUST00000164648
SMART Domains Protein: ENSMUSP00000130761
Gene: ENSMUSG00000030199

DomainStartEndE-ValueType
SAM_PNT 38 124 3.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204426
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (64/66)
MGI Phenotype Strain: 2177950; 3056143
Lethality: E11-E14
FUNCTION: This gene encodes a transcriptional repressor belonging to the ETS family of proteins. Knockout of this gene in mice results in embryonic lethality due to defective angiogenesis. In humans, this gene is often involved in chromosome rearrangements associated with specific cancers. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defective yolk sac angiogenesis, excess apoptosis of mesenchymal and neural cells, and midgestational lethality. [provided by MGI curators]
Allele List at MGI

All alleles(134) : Targeted(7) Gene trapped(127)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,729 W156R probably damaging Het
Acvr1 T A 2: 58,474,274 probably null Het
Adamts2 G T 11: 50,603,488 V130L probably damaging Het
Adcy4 C T 14: 55,775,240 V541I probably benign Het
Adgrl2 C T 3: 148,846,906 V654I probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 A T 14: 78,512,489 S819R Het
Alox5ap T C 5: 149,287,609 F121L probably damaging Het
Baz2b A T 2: 59,901,514 M2060K probably damaging Het
C030005K15Rik T C 10: 97,725,552 I106V unknown Het
Carmil2 T A 8: 105,691,084 S604T probably benign Het
Cdhr1 T C 14: 37,091,978 T164A probably benign Het
Dhx30 T C 9: 110,085,501 E976G possibly damaging Het
Dnah17 C T 11: 118,114,195 G788R probably benign Het
Dus2 T C 8: 105,996,013 probably benign Het
Fabp9 T G 3: 10,194,025 K107T possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gapdh A G 6: 125,163,263 V92A probably benign Het
Gfy A G 7: 45,176,595 L453P probably damaging Het
Gm6588 C T 5: 112,450,787 T400I probably benign Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gtpbp8 T C 16: 44,746,313 R9G probably benign Het
Hipk4 G T 7: 27,523,608 R31L probably damaging Het
Htt T A 5: 34,905,724 M2900K probably damaging Het
Ighv1-20 T C 12: 114,724,190 I6V probably benign Het
Il17d C T 14: 57,542,480 T153I probably damaging Het
Izumo3 T A 4: 92,146,344 N117I probably damaging Het
Kcnh7 T C 2: 62,850,535 D236G probably benign Het
Kmt2d T C 15: 98,852,597 D2405G unknown Het
Map4k2 T C 19: 6,346,566 W533R probably damaging Het
Matn1 C A 4: 130,945,989 Y89* probably null Het
Mettl18 T A 1: 163,996,940 Y277N probably damaging Het
Muc5b G A 7: 141,864,161 G3615S probably benign Het
Mycbp2 A C 14: 103,160,675 probably null Het
Myh4 T A 11: 67,252,564 S1041T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naaladl1 T C 19: 6,109,673 V378A possibly damaging Het
Nars T C 18: 64,504,387 D374G probably benign Het
Neb C T 2: 52,308,271 probably null Het
Neurl1b A G 17: 26,431,991 Y79C probably damaging Het
Nynrin A G 14: 55,863,791 T306A probably benign Het
Ola1 G T 2: 73,199,401 R125S probably damaging Het
Olfr105-ps T A 17: 37,383,231 F221L probably benign Het
Olfr644 A T 7: 104,068,176 V285D probably damaging Het
Pak1ip1 C A 13: 41,004,738 T29K probably benign Het
Podnl1 T A 8: 84,130,773 L337H Het
Rictor T G 15: 6,778,319 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sel1l2 T C 2: 140,230,833 I627M probably benign Het
Sh3rf2 T C 18: 42,111,428 S352P probably damaging Het
Slc6a6 G A 6: 91,726,243 W199* probably null Het
Smc2 T A 4: 52,450,965 V261E probably benign Het
Sorcs3 G A 19: 48,704,369 probably null Het
Spdye4a T A 5: 143,225,807 M1L probably benign Het
Stag1 T C 9: 100,757,766 I125T possibly damaging Het
Stx8 T A 11: 68,020,988 D177E probably benign Het
Sun2 T C 15: 79,738,924 Y71C probably damaging Het
Tmed9 T C 13: 55,594,804 F129L probably benign Het
Tmem216 T A 19: 10,551,972 T17S probably benign Het
Tmpo A T 10: 91,162,112 N604K probably benign Het
Tmprss11f T A 5: 86,533,807 I196F probably benign Het
Tnks A G 8: 34,834,584 F1244L probably benign Het
Tspan2 T C 3: 102,768,910 C212R probably damaging Het
Tspan4 A G 7: 141,491,805 D155G probably damaging Het
Ttc6 T C 12: 57,660,496 F730L possibly damaging Het
Txnrd2 G A 16: 18,426,541 A33T unknown Het
Uhrf1bp1l T C 10: 89,791,419 S449P probably benign Het
Wnk1 C T 6: 119,963,493 R761H probably damaging Het
Zfp217 T C 2: 170,120,104 D101G probably damaging Het
Zfp281 T C 1: 136,627,882 F866S probably damaging Het
Other mutations in Etv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Etv6 APN 6 134248387 missense probably benign 0.41
IGL02028:Etv6 APN 6 134248733 missense probably benign 0.01
IGL02173:Etv6 APN 6 134248727 missense possibly damaging 0.68
IGL03074:Etv6 APN 6 134222925 missense probably damaging 0.98
R0056:Etv6 UTSW 6 134248534 nonsense probably null
R0295:Etv6 UTSW 6 134266275 missense probably benign 0.31
R2133:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R3763:Etv6 UTSW 6 134263012 splice site probably benign
R4405:Etv6 UTSW 6 134233534 missense probably damaging 1.00
R6901:Etv6 UTSW 6 134266458 missense probably benign 0.10
R8292:Etv6 UTSW 6 134248546 missense probably benign
R8752:Etv6 UTSW 6 134266428 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGAGAATAATCACTGCCTGCCC -3'
(R):5'- TGGGCTCATAACACTGCCAG -3'

Sequencing Primer
(F):5'- TAATCACTGCCTGCCCTCAAG -3'
(R):5'- CCAGTGGCGTGTGGCTG -3'
Posted On 2020-09-02