Incidental Mutation 'R8343:Gp2'
ID645018
Institutional Source Beutler Lab
Gene Symbol Gp2
Ensembl Gene ENSMUSG00000030954
Gene Nameglycoprotein 2 (zymogen granule membrane)
Synonyms2310037I18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8343 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119442537-119459285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119442787 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 505 (C505Y)
Ref Sequence ENSEMBL: ENSMUSP00000146487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033255] [ENSMUST00000207887]
Predicted Effect silent
Transcript: ENSMUST00000033255
SMART Domains Protein: ENSMUSP00000033255
Gene: ENSMUSG00000030954

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:ZP 164 213 1e-11 BLAST
ZP 225 477 5.39e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207887
AA Change: C505Y

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is secreted from intracellular zymogen granules and associates with the plasma membrane via glycosylphosphatidylinositol (GPI) linkage. The encoded protein binds pathogens such as enterobacteria, thereby playing an important role in the innate immune response. The C-terminus of this protein is related to the C-terminus of the protein encoded by the neighboring gene, uromodulin (UMOD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mice display no obvious abnormalities in pancreas morphology and function, development, growth, weight, behavior, life span, or fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,729 W156R probably damaging Het
Acvr1 T A 2: 58,474,274 probably null Het
Adamts2 G T 11: 50,603,488 V130L probably damaging Het
Adcy4 C T 14: 55,775,240 V541I probably benign Het
Adgrl2 C T 3: 148,846,906 V654I probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 A T 14: 78,512,489 S819R Het
Alox5ap T C 5: 149,287,609 F121L probably damaging Het
Baz2b A T 2: 59,901,514 M2060K probably damaging Het
C030005K15Rik T C 10: 97,725,552 I106V unknown Het
Carmil2 T A 8: 105,691,084 S604T probably benign Het
Cdhr1 T C 14: 37,091,978 T164A probably benign Het
Dhx30 T C 9: 110,085,501 E976G possibly damaging Het
Dnah17 C T 11: 118,114,195 G788R probably benign Het
Dus2 T C 8: 105,996,013 probably benign Het
Etv6 T C 6: 134,248,754 V316A possibly damaging Het
Fabp9 T G 3: 10,194,025 K107T possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gapdh A G 6: 125,163,263 V92A probably benign Het
Gfy A G 7: 45,176,595 L453P probably damaging Het
Gm6588 C T 5: 112,450,787 T400I probably benign Het
Gtpbp8 T C 16: 44,746,313 R9G probably benign Het
Hipk4 G T 7: 27,523,608 R31L probably damaging Het
Htt T A 5: 34,905,724 M2900K probably damaging Het
Ighv1-20 T C 12: 114,724,190 I6V probably benign Het
Il17d C T 14: 57,542,480 T153I probably damaging Het
Izumo3 T A 4: 92,146,344 N117I probably damaging Het
Kcnh7 T C 2: 62,850,535 D236G probably benign Het
Kmt2d T C 15: 98,852,597 D2405G unknown Het
Map4k2 T C 19: 6,346,566 W533R probably damaging Het
Matn1 C A 4: 130,945,989 Y89* probably null Het
Mettl18 T A 1: 163,996,940 Y277N probably damaging Het
Muc5b G A 7: 141,864,161 G3615S probably benign Het
Myh4 T A 11: 67,252,564 S1041T possibly damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naaladl1 T C 19: 6,109,673 V378A possibly damaging Het
Nars T C 18: 64,504,387 D374G probably benign Het
Neurl1b A G 17: 26,431,991 Y79C probably damaging Het
Nynrin A G 14: 55,863,791 T306A probably benign Het
Ola1 G T 2: 73,199,401 R125S probably damaging Het
Olfr105-ps T A 17: 37,383,231 F221L probably benign Het
Olfr644 A T 7: 104,068,176 V285D probably damaging Het
Pak1ip1 C A 13: 41,004,738 T29K probably benign Het
Podnl1 T A 8: 84,130,773 L337H Het
Rictor T G 15: 6,778,319 probably null Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sel1l2 T C 2: 140,230,833 I627M probably benign Het
Sh3rf2 T C 18: 42,111,428 S352P probably damaging Het
Slc6a6 G A 6: 91,726,243 W199* probably null Het
Smc2 T A 4: 52,450,965 V261E probably benign Het
Spdye4a T A 5: 143,225,807 M1L probably benign Het
Stag1 T C 9: 100,757,766 I125T possibly damaging Het
Stx8 T A 11: 68,020,988 D177E probably benign Het
Sun2 T C 15: 79,738,924 Y71C probably damaging Het
Tmed9 T C 13: 55,594,804 F129L probably benign Het
Tmem216 T A 19: 10,551,972 T17S probably benign Het
Tmpo A T 10: 91,162,112 N604K probably benign Het
Tmprss11f T A 5: 86,533,807 I196F probably benign Het
Tnks A G 8: 34,834,584 F1244L probably benign Het
Tspan2 T C 3: 102,768,910 C212R probably damaging Het
Tspan4 A G 7: 141,491,805 D155G probably damaging Het
Ttc6 T C 12: 57,660,496 F730L possibly damaging Het
Txnrd2 G A 16: 18,426,541 A33T unknown Het
Uhrf1bp1l T C 10: 89,791,419 S449P probably benign Het
Wnk1 C T 6: 119,963,493 R761H probably damaging Het
Zfp217 T C 2: 170,120,104 D101G probably damaging Het
Zfp281 T C 1: 136,627,882 F866S probably damaging Het
Other mutations in Gp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gp2 APN 7 119454390 missense probably damaging 0.96
IGL00818:Gp2 APN 7 119450127 missense possibly damaging 0.82
IGL01830:Gp2 APN 7 119451542 missense probably damaging 1.00
IGL02088:Gp2 APN 7 119454469 missense probably damaging 1.00
IGL02284:Gp2 APN 7 119450183 missense probably damaging 1.00
IGL02812:Gp2 APN 7 119452229 missense probably benign 0.01
IGL03049:Gp2 APN 7 119450294 missense possibly damaging 0.82
IGL03368:Gp2 APN 7 119452874 missense probably damaging 1.00
IGL03369:Gp2 APN 7 119451560 missense probably damaging 0.98
PIT4687001:Gp2 UTSW 7 119451578 missense possibly damaging 0.48
R0179:Gp2 UTSW 7 119452317 missense possibly damaging 0.81
R0367:Gp2 UTSW 7 119454568 missense probably damaging 1.00
R0544:Gp2 UTSW 7 119454496 missense probably benign 0.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0974:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R1413:Gp2 UTSW 7 119451630 missense probably benign 0.15
R1557:Gp2 UTSW 7 119450079 missense probably damaging 1.00
R1638:Gp2 UTSW 7 119451498 critical splice donor site probably null
R1709:Gp2 UTSW 7 119451585 missense probably null 1.00
R1932:Gp2 UTSW 7 119454232 missense possibly damaging 0.81
R2109:Gp2 UTSW 7 119452932 missense probably benign
R2159:Gp2 UTSW 7 119452284 missense probably benign 0.06
R2285:Gp2 UTSW 7 119450085 missense possibly damaging 0.82
R4657:Gp2 UTSW 7 119457168 missense probably benign 0.38
R4829:Gp2 UTSW 7 119457184 missense possibly damaging 0.56
R4854:Gp2 UTSW 7 119452199 missense possibly damaging 0.72
R4927:Gp2 UTSW 7 119452895 missense probably benign 0.00
R5022:Gp2 UTSW 7 119449114 missense probably damaging 1.00
R5033:Gp2 UTSW 7 119454291 missense probably damaging 0.99
R5443:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5444:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5681:Gp2 UTSW 7 119452294 missense possibly damaging 0.92
R5732:Gp2 UTSW 7 119449108 missense probably damaging 1.00
R5964:Gp2 UTSW 7 119449129 missense probably benign 0.02
R6963:Gp2 UTSW 7 119452897 missense probably benign 0.03
R7014:Gp2 UTSW 7 119451645 missense probably damaging 1.00
R7087:Gp2 UTSW 7 119450232 missense probably damaging 0.99
R7223:Gp2 UTSW 7 119451498 critical splice donor site probably null
R7497:Gp2 UTSW 7 119454606 missense probably damaging 1.00
R8165:Gp2 UTSW 7 119450152 missense probably damaging 1.00
R8344:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8345:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8431:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8432:Gp2 UTSW 7 119442787 missense probably benign 0.01
X0026:Gp2 UTSW 7 119442819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGCTGTCAGAACAAGAGGCATTTTG -3'
(R):5'- AAGCAGTTGTTGTCCCAAAC -3'

Sequencing Primer
(F):5'- TGAAAGGATCATGGGATTTGCCC -3'
(R):5'- GGTACTTCTGCAGCAAGT -3'
Posted On2020-09-02