Incidental Mutation 'R0026:Rrm2b'
Institutional Source Beutler Lab
Gene Symbol Rrm2b
Ensembl Gene ENSMUSG00000022292
Gene Nameribonucleotide reductase M2 B (TP53 inducible)
MMRRC Submission 038321-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0026 (G1)
Quality Score120
Status Validated
Chromosomal Location37923952-37961318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37953741 bp
Amino Acid Change Glutamic Acid to Glycine at position 21 (E21G)
Ref Sequence ENSEMBL: ENSMUSP00000121188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022901] [ENSMUST00000137636] [ENSMUST00000144498] [ENSMUST00000145155] [ENSMUST00000145175] [ENSMUST00000146821] [ENSMUST00000153481]
Predicted Effect probably benign
Transcript: ENSMUST00000022901
AA Change: E21G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022901
Gene: ENSMUSG00000022292
AA Change: E21G

Pfam:Ribonuc_red_sm 41 308 4.2e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127362
Predicted Effect probably benign
Transcript: ENSMUST00000137636
SMART Domains Protein: ENSMUSP00000119400
Gene: ENSMUSG00000022292

Pfam:Ribonuc_red_sm 6 261 1.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144498
AA Change: E21G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121069
Gene: ENSMUSG00000022292
AA Change: E21G

Pfam:Ribonuc_red_sm 32 111 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145155
Predicted Effect probably benign
Transcript: ENSMUST00000145175
AA Change: E7G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114343
Gene: ENSMUSG00000022292
AA Change: E7G

Pfam:Ribonuc_red_sm 18 99 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146821
SMART Domains Protein: ENSMUSP00000123691
Gene: ENSMUSG00000022292

Pfam:Ribonuc_red_sm 13 101 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153481
AA Change: E21G

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 93% (70/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Loss of both functional copies of this gene results in growth retardation, multiple organ failure, and ultimately premature death due to kidney failure. Spontaneous mutation rates and apoptosis are increased in the kidneys due to an attenuation of dNTP pools and a resulting impairment of DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,066,805 I585N possibly damaging Het
4931408C20Rik T A 1: 26,683,369 D910V probably benign Het
A830005F24Rik C T 13: 48,514,372 probably benign Het
Abca16 C T 7: 120,477,923 probably benign Het
Acot10 G A 15: 20,666,236 L140F probably benign Het
Adam19 G T 11: 46,136,259 C573F probably damaging Het
Aff3 A G 1: 38,203,893 S948P probably benign Het
Anxa3 T A 5: 96,838,401 Y300N probably benign Het
BC016579 T C 16: 45,640,367 T113A probably benign Het
Bmpr1b A G 3: 141,870,733 L113P probably benign Het
Casq1 T C 1: 172,219,400 probably benign Het
Cdc16 T A 8: 13,759,130 probably null Het
Cep135 C T 5: 76,606,734 R353* probably null Het
Cma1 A T 14: 55,942,164 C188S probably damaging Het
Csf3r A G 4: 126,031,884 T151A probably benign Het
Cyp4b1 C T 4: 115,647,521 G56D possibly damaging Het
Dbn1 T C 13: 55,477,784 E275G probably damaging Het
Dlgap2 C T 8: 14,727,363 Q203* probably null Het
Ephb3 A G 16: 21,214,917 D251G probably damaging Het
Fancd2os G T 6: 113,597,691 T118N probably damaging Het
Gm10801 T C 2: 98,663,909 probably benign Het
Got1l1 C T 8: 27,200,248 V132I probably benign Het
H2-M9 T C 17: 36,641,527 probably benign Het
Ibtk A G 9: 85,690,303 V1278A probably benign Het
Kctd3 T C 1: 188,976,621 T519A probably damaging Het
Lgsn T A 1: 31,203,443 V202D probably damaging Het
Madd A G 2: 91,175,708 F381L possibly damaging Het
Map1s G A 8: 70,914,638 G729D probably damaging Het
Mlycd A G 8: 119,410,435 I465V probably benign Het
Mrgprb1 T C 7: 48,447,204 R108G possibly damaging Het
Mrgprx2 T A 7: 48,482,023 H106L possibly damaging Het
Ncor1 T C 11: 62,438,429 Y6C probably damaging Het
Nfkb1 T C 3: 135,591,573 D773G probably damaging Het
Nxnl1 A G 8: 71,566,573 S3P probably damaging Het
Olfr109 T A 17: 37,466,803 V199D probably damaging Het
Olfr921 G A 9: 38,775,596 V114I probably benign Het
Otud7a T C 7: 63,735,801 F338L probably benign Het
Pdcl3 T A 1: 38,991,280 L14Q probably damaging Het
Pla2g7 T A 17: 43,594,930 probably benign Het
Prpf31 T A 7: 3,639,668 N413K probably benign Het
Rapgef5 T C 12: 117,689,161 S307P probably benign Het
Relt C A 7: 100,850,221 E164* probably null Het
Rnf185 T C 11: 3,426,617 D86G probably damaging Het
Scn5a A G 9: 119,522,566 I783T probably damaging Het
Senp1 T C 15: 98,076,668 R88G probably damaging Het
Skint5 A T 4: 113,546,468 probably benign Het
Slc35b1 T C 11: 95,390,642 S294P probably benign Het
Slc5a2 T A 7: 128,270,053 I335N probably damaging Het
Sstr1 T A 12: 58,212,858 M89K probably damaging Het
Szt2 A T 4: 118,384,772 S1612R possibly damaging Het
Taf1c T C 8: 119,604,236 probably null Het
Taf1d T A 9: 15,308,648 S64R probably damaging Het
Tmem125 A G 4: 118,542,073 S54P possibly damaging Het
Ttf1 T A 2: 29,071,349 I583N possibly damaging Het
Uchl4 A T 9: 64,235,371 probably null Het
Unc5b A T 10: 60,774,592 I482N possibly damaging Het
Unc80 C A 1: 66,521,584 Q824K probably benign Het
Utrn T C 10: 12,726,196 probably benign Het
Vmn2r61 T G 7: 42,275,474 I484R possibly damaging Het
Vps13b T C 15: 35,923,301 I3774T possibly damaging Het
Yipf1 T A 4: 107,345,160 L240* probably null Het
Other mutations in Rrm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Rrm2b APN 15 37929075 missense probably damaging 1.00
IGL00806:Rrm2b APN 15 37931622 missense probably benign 0.02
IGL01145:Rrm2b APN 15 37944560 missense probably damaging 0.96
norfolk UTSW 15 37937351 critical splice acceptor site probably null
rememberance UTSW 15 37946800 missense possibly damaging 0.65
PIT4515001:Rrm2b UTSW 15 37946804 missense probably benign
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0624:Rrm2b UTSW 15 37931645 missense probably benign 0.00
R1371:Rrm2b UTSW 15 37946809 missense probably benign 0.06
R1635:Rrm2b UTSW 15 37945084 missense probably damaging 1.00
R1692:Rrm2b UTSW 15 37927322 nonsense probably null
R1710:Rrm2b UTSW 15 37929096 missense probably damaging 1.00
R2273:Rrm2b UTSW 15 37945051 missense possibly damaging 0.92
R3196:Rrm2b UTSW 15 37945147 splice site probably null
R4459:Rrm2b UTSW 15 37945153 splice site probably null
R5310:Rrm2b UTSW 15 37927327 missense probably damaging 1.00
R5747:Rrm2b UTSW 15 37927390 missense probably benign
R7343:Rrm2b UTSW 15 37944573 missense probably benign 0.18
R7378:Rrm2b UTSW 15 37931647 missense probably benign
R7539:Rrm2b UTSW 15 37937351 critical splice acceptor site probably null
R7797:Rrm2b UTSW 15 37927261 nonsense probably null
R8077:Rrm2b UTSW 15 37946800 missense possibly damaging 0.65
R8856:Rrm2b UTSW 15 37960614 intron probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtaagtatatccgaagaaagcgag -3'
Posted On2013-08-06