Incidental Mutation 'R8344:Clca3a2'
ID 645073
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R8344 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 144805942 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably null
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197013
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,911,119 Y83F possibly damaging Het
Adgre1 C G 17: 57,408,459 Q260E probably benign Het
Adgrf4 T A 17: 42,666,908 M515L probably benign Het
Adgrl2 A T 3: 148,859,525 C140S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Ampd1 A T 3: 103,095,686 E573V possibly damaging Het
Atxn7l3b T A 10: 112,928,662 I21F possibly damaging Het
Bckdha C T 7: 25,631,447 R298H probably damaging Het
Cacng3 A C 7: 122,768,346 I150L possibly damaging Het
Ccdc18 A T 5: 108,161,503 K321N possibly damaging Het
Ccl11 A T 11: 82,061,742 K47M possibly damaging Het
Cdkn2a T C 4: 89,276,750 I142M probably benign Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Chrna1 C A 2: 73,570,609 E192D probably benign Het
Clasp1 A G 1: 118,503,899 N420D probably damaging Het
Cntn2 T C 1: 132,521,774 Y643C probably damaging Het
Dcun1d1 G A 3: 35,897,554 H204Y probably benign Het
Dlg2 A T 7: 92,438,014 Q767L possibly damaging Het
Dnah11 A G 12: 118,085,731 S1653P probably benign Het
Dvl3 T A 16: 20,523,763 probably null Het
Egf T C 3: 129,754,943 T8A unknown Het
Eln G T 5: 134,728,392 T219K unknown Het
Evc T C 5: 37,314,528 D536G possibly damaging Het
Fbxo3 A G 2: 104,051,208 E295G possibly damaging Het
Gm14548 T A 7: 3,896,955 E216V possibly damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gpr37 A G 6: 25,669,531 F438S probably damaging Het
Gsk3b T C 16: 38,191,625 S236P probably benign Het
Kdm5d A G Y: 942,477 T1381A probably benign Het
Klhl12 T C 1: 134,485,722 I315T possibly damaging Het
Ltb T A 17: 35,195,193 N102K probably benign Het
Macf1 C A 4: 123,384,683 D5993Y probably damaging Het
Macf1 T C 4: 123,526,856 T202A probably benign Het
Mak T A 13: 41,046,203 D320V probably benign Het
Map2 G A 1: 66,421,713 R1556H probably damaging Het
Mgat4d G T 8: 83,368,133 M266I probably benign Het
Mmp24 G T 2: 155,810,303 R310S possibly damaging Het
Myh6 A T 14: 54,953,434 L928Q probably damaging Het
Npnt A G 3: 132,908,456 L179P probably damaging Het
Olfr1205 A G 2: 88,831,383 I89V probably benign Het
Olfr38 A G 6: 42,762,565 N171S probably benign Het
Olfr972 T G 9: 39,873,935 F220C probably benign Het
Parp4 A T 14: 56,648,729 Y1755F unknown Het
Phactr1 A G 13: 42,709,821 E74G possibly damaging Het
Plcg1 G A 2: 160,747,896 M113I probably benign Het
Plekhh2 T G 17: 84,571,761 S638A possibly damaging Het
Ppp2r3a T A 9: 101,211,786 H446L probably benign Het
Prkcg G T 7: 3,330,170 D644Y probably damaging Het
Rbbp8nl G T 2: 180,279,713 R293S probably benign Het
Rbl2 A T 8: 91,115,759 H1057L possibly damaging Het
Rpgrip1 A T 14: 52,150,362 H1076L possibly damaging Het
Scn11a A C 9: 119,781,970 D938E probably benign Het
Sec24b T C 3: 130,005,001 D573G probably damaging Het
Serpinf1 T G 11: 75,415,571 Q147P unknown Het
Skint6 C T 4: 113,236,445 G167D probably damaging Het
Slc15a5 A G 6: 138,079,900 F6S probably damaging Het
Smc2 T A 4: 52,449,376 I179K probably benign Het
Smpdl3a A G 10: 57,800,977 K57R possibly damaging Het
Smpdl3b T A 4: 132,746,679 H25L probably damaging Het
Srpk1 T C 17: 28,620,424 D35G unknown Het
Strn A G 17: 78,672,647 V324A probably damaging Het
Sult6b2 T C 6: 142,790,296 K191E probably benign Het
Tmem168 A G 6: 13,583,325 I519T probably benign Het
Tmem41a T C 16: 21,938,034 T112A probably benign Het
Tmem67 A G 4: 12,058,576 I507T probably benign Het
Tns1 T C 1: 73,985,042 E454G probably damaging Het
Trim26 C A 17: 36,857,710 D422E unknown Het
Triobp C A 15: 78,958,275 R58S possibly damaging Het
Trp53 T C 11: 69,587,583 F106S probably damaging Het
Tshz3 C A 7: 36,771,537 Q984K probably damaging Het
Ttll3 A G 6: 113,394,998 E73G probably damaging Het
Vmn1r194 A G 13: 22,245,077 N288S probably benign Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6593:Clca3a2 UTSW 3 144808577 critical splice donor site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
R9569:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCTGACCCGTACATACAC -3'
(R):5'- GGCACTGCAGAGGTAAGTCTATTC -3'

Sequencing Primer
(F):5'- ACAATCATCCGGCTAGGGTACTG -3'
(R):5'- GCAGAGGTAAGTCTATTCTTTTCACC -3'
Posted On 2020-09-02