Incidental Mutation 'R8344:Skint6'
ID 645078
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8344 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 113093642 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 167 (G167D)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000138966
AA Change: G167D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: G167D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171224
AA Change: G167D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: G167D

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,888,519 (GRCm39) Y83F possibly damaging Het
Adgre1 C G 17: 57,715,459 (GRCm39) Q260E probably benign Het
Adgrf4 T A 17: 42,977,799 (GRCm39) M515L probably benign Het
Adgrl2 A T 3: 148,565,161 (GRCm39) C140S probably damaging Het
Ago3 T A 4: 126,270,721 (GRCm39) K258* probably null Het
Ampd1 A T 3: 103,003,002 (GRCm39) E573V possibly damaging Het
Atxn7l3b T A 10: 112,764,567 (GRCm39) I21F possibly damaging Het
Bckdha C T 7: 25,330,872 (GRCm39) R298H probably damaging Het
Cacng3 A C 7: 122,367,569 (GRCm39) I150L possibly damaging Het
Ccdc18 A T 5: 108,309,369 (GRCm39) K321N possibly damaging Het
Ccl11 A T 11: 81,952,568 (GRCm39) K47M possibly damaging Het
Cdkn2a T C 4: 89,194,987 (GRCm39) I142M probably benign Het
Cfap65 C T 1: 74,967,203 (GRCm39) G249R probably benign Het
Chrna1 C A 2: 73,400,953 (GRCm39) E192D probably benign Het
Clasp1 A G 1: 118,431,629 (GRCm39) N420D probably damaging Het
Clca3a2 T A 3: 144,511,703 (GRCm39) probably null Het
Cntn2 T C 1: 132,449,512 (GRCm39) Y643C probably damaging Het
Dcun1d1 G A 3: 35,951,703 (GRCm39) H204Y probably benign Het
Dlg2 A T 7: 92,087,222 (GRCm39) Q767L possibly damaging Het
Dnah11 A G 12: 118,049,466 (GRCm39) S1653P probably benign Het
Dvl3 T A 16: 20,342,513 (GRCm39) probably null Het
Egf T C 3: 129,548,592 (GRCm39) T8A unknown Het
Eln G T 5: 134,757,246 (GRCm39) T219K unknown Het
Evc T C 5: 37,471,872 (GRCm39) D536G possibly damaging Het
Fbxo3 A G 2: 103,881,553 (GRCm39) E295G possibly damaging Het
Gp2 C T 7: 119,042,010 (GRCm39) C505Y probably benign Het
Gpr37 A G 6: 25,669,530 (GRCm39) F438S probably damaging Het
Gsk3b T C 16: 38,011,987 (GRCm39) S236P probably benign Het
Kdm5d A G Y: 942,477 (GRCm39) T1381A probably benign Het
Klhl12 T C 1: 134,413,460 (GRCm39) I315T possibly damaging Het
Ltb T A 17: 35,414,169 (GRCm39) N102K probably benign Het
Macf1 T C 4: 123,420,649 (GRCm39) T202A probably benign Het
Macf1 C A 4: 123,278,476 (GRCm39) D5993Y probably damaging Het
Mak T A 13: 41,199,679 (GRCm39) D320V probably benign Het
Map2 G A 1: 66,460,872 (GRCm39) R1556H probably damaging Het
Mgat4d G T 8: 84,094,762 (GRCm39) M266I probably benign Het
Mmp24 G T 2: 155,652,223 (GRCm39) R310S possibly damaging Het
Myh6 A T 14: 55,190,891 (GRCm39) L928Q probably damaging Het
Npnt A G 3: 132,614,217 (GRCm39) L179P probably damaging Het
Or2f1b A G 6: 42,739,499 (GRCm39) N171S probably benign Het
Or4c11c A G 2: 88,661,727 (GRCm39) I89V probably benign Het
Or8g55 T G 9: 39,785,231 (GRCm39) F220C probably benign Het
Parp4 A T 14: 56,886,186 (GRCm39) Y1755F unknown Het
Phactr1 A G 13: 42,863,297 (GRCm39) E74G possibly damaging Het
Pira12 T A 7: 3,899,954 (GRCm39) E216V possibly damaging Het
Plcg1 G A 2: 160,589,816 (GRCm39) M113I probably benign Het
Plekhh2 T G 17: 84,879,189 (GRCm39) S638A possibly damaging Het
Ppp2r3d T A 9: 101,088,985 (GRCm39) H446L probably benign Het
Prkcg G T 7: 3,378,686 (GRCm39) D644Y probably damaging Het
Rbbp8nl G T 2: 179,921,506 (GRCm39) R293S probably benign Het
Rbl2 A T 8: 91,842,387 (GRCm39) H1057L possibly damaging Het
Rpgrip1 A T 14: 52,387,819 (GRCm39) H1076L possibly damaging Het
Scn11a A C 9: 119,611,036 (GRCm39) D938E probably benign Het
Sec24b T C 3: 129,798,650 (GRCm39) D573G probably damaging Het
Serpinf1 T G 11: 75,306,397 (GRCm39) Q147P unknown Het
Slc15a5 A G 6: 138,056,898 (GRCm39) F6S probably damaging Het
Smc2 T A 4: 52,449,376 (GRCm39) I179K probably benign Het
Smpdl3a A G 10: 57,677,073 (GRCm39) K57R possibly damaging Het
Smpdl3b T A 4: 132,473,990 (GRCm39) H25L probably damaging Het
Srpk1 T C 17: 28,839,398 (GRCm39) D35G unknown Het
Strn A G 17: 78,980,076 (GRCm39) V324A probably damaging Het
Sult6b2 T C 6: 142,736,022 (GRCm39) K191E probably benign Het
Tmem168 A G 6: 13,583,324 (GRCm39) I519T probably benign Het
Tmem41a T C 16: 21,756,784 (GRCm39) T112A probably benign Het
Tmem67 A G 4: 12,058,576 (GRCm39) I507T probably benign Het
Tns1 T C 1: 74,024,201 (GRCm39) E454G probably damaging Het
Trim26 C A 17: 37,168,602 (GRCm39) D422E unknown Het
Triobp C A 15: 78,842,475 (GRCm39) R58S possibly damaging Het
Trp53 T C 11: 69,478,409 (GRCm39) F106S probably damaging Het
Tshz3 C A 7: 36,470,962 (GRCm39) Q984K probably damaging Het
Ttll3 A G 6: 113,371,959 (GRCm39) E73G probably damaging Het
Vmn1r194 A G 13: 22,429,247 (GRCm39) N288S probably benign Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCTGGTAGGACAAAGCTTATG -3'
(R):5'- AGAGCCCTGTAGCCTTTTCAC -3'

Sequencing Primer
(F):5'- GCTTTCTTCTTGGTGAGTTACAAAG -3'
(R):5'- GCTACAAGCTCAGACATACA -3'
Posted On 2020-09-02