Incidental Mutation 'R8344:Gpr37'
ID 645087
Institutional Source Beutler Lab
Gene Symbol Gpr37
Ensembl Gene ENSMUSG00000039904
Gene Name G protein-coupled receptor 37
Synonyms parkin-associated endothelin B-like receptor, Pael-R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R8344 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 25665878-25690729 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25669531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 438 (F438S)
Ref Sequence ENSEMBL: ENSMUSP00000052185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]
AlphaFold Q9QY42
Predicted Effect probably damaging
Transcript: ENSMUST00000054867
AA Change: F438S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: F438S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 536 5.2e-33 PFAM
low complexity region 549 558 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200812
SMART Domains Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Pfam:7tm_1 265 421 3.4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,911,119 Y83F possibly damaging Het
Adgre1 C G 17: 57,408,459 Q260E probably benign Het
Adgrf4 T A 17: 42,666,908 M515L probably benign Het
Adgrl2 A T 3: 148,859,525 C140S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Ampd1 A T 3: 103,095,686 E573V possibly damaging Het
Atxn7l3b T A 10: 112,928,662 I21F possibly damaging Het
Bckdha C T 7: 25,631,447 R298H probably damaging Het
Cacng3 A C 7: 122,768,346 I150L possibly damaging Het
Ccdc18 A T 5: 108,161,503 K321N possibly damaging Het
Ccl11 A T 11: 82,061,742 K47M possibly damaging Het
Cdkn2a T C 4: 89,276,750 I142M probably benign Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Chrna1 C A 2: 73,570,609 E192D probably benign Het
Clasp1 A G 1: 118,503,899 N420D probably damaging Het
Clca3a2 T A 3: 144,805,942 probably null Het
Cntn2 T C 1: 132,521,774 Y643C probably damaging Het
Dcun1d1 G A 3: 35,897,554 H204Y probably benign Het
Dlg2 A T 7: 92,438,014 Q767L possibly damaging Het
Dnah11 A G 12: 118,085,731 S1653P probably benign Het
Dvl3 T A 16: 20,523,763 probably null Het
Egf T C 3: 129,754,943 T8A unknown Het
Eln G T 5: 134,728,392 T219K unknown Het
Evc T C 5: 37,314,528 D536G possibly damaging Het
Fbxo3 A G 2: 104,051,208 E295G possibly damaging Het
Gm14548 T A 7: 3,896,955 E216V possibly damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gsk3b T C 16: 38,191,625 S236P probably benign Het
Kdm5d A G Y: 942,477 T1381A probably benign Het
Klhl12 T C 1: 134,485,722 I315T possibly damaging Het
Ltb T A 17: 35,195,193 N102K probably benign Het
Macf1 C A 4: 123,384,683 D5993Y probably damaging Het
Macf1 T C 4: 123,526,856 T202A probably benign Het
Mak T A 13: 41,046,203 D320V probably benign Het
Map2 G A 1: 66,421,713 R1556H probably damaging Het
Mgat4d G T 8: 83,368,133 M266I probably benign Het
Mmp24 G T 2: 155,810,303 R310S possibly damaging Het
Myh6 A T 14: 54,953,434 L928Q probably damaging Het
Npnt A G 3: 132,908,456 L179P probably damaging Het
Olfr1205 A G 2: 88,831,383 I89V probably benign Het
Olfr38 A G 6: 42,762,565 N171S probably benign Het
Olfr972 T G 9: 39,873,935 F220C probably benign Het
Parp4 A T 14: 56,648,729 Y1755F unknown Het
Phactr1 A G 13: 42,709,821 E74G possibly damaging Het
Plcg1 G A 2: 160,747,896 M113I probably benign Het
Plekhh2 T G 17: 84,571,761 S638A possibly damaging Het
Ppp2r3a T A 9: 101,211,786 H446L probably benign Het
Prkcg G T 7: 3,330,170 D644Y probably damaging Het
Rbbp8nl G T 2: 180,279,713 R293S probably benign Het
Rbl2 A T 8: 91,115,759 H1057L possibly damaging Het
Rpgrip1 A T 14: 52,150,362 H1076L possibly damaging Het
Scn11a A C 9: 119,781,970 D938E probably benign Het
Sec24b T C 3: 130,005,001 D573G probably damaging Het
Serpinf1 T G 11: 75,415,571 Q147P unknown Het
Skint6 C T 4: 113,236,445 G167D probably damaging Het
Slc15a5 A G 6: 138,079,900 F6S probably damaging Het
Smc2 T A 4: 52,449,376 I179K probably benign Het
Smpdl3a A G 10: 57,800,977 K57R possibly damaging Het
Smpdl3b T A 4: 132,746,679 H25L probably damaging Het
Srpk1 T C 17: 28,620,424 D35G unknown Het
Strn A G 17: 78,672,647 V324A probably damaging Het
Sult6b2 T C 6: 142,790,296 K191E probably benign Het
Tmem168 A G 6: 13,583,325 I519T probably benign Het
Tmem41a T C 16: 21,938,034 T112A probably benign Het
Tmem67 A G 4: 12,058,576 I507T probably benign Het
Tns1 T C 1: 73,985,042 E454G probably damaging Het
Trim26 C A 17: 36,857,710 D422E unknown Het
Triobp C A 15: 78,958,275 R58S possibly damaging Het
Trp53 T C 11: 69,587,583 F106S probably damaging Het
Tshz3 C A 7: 36,771,537 Q984K probably damaging Het
Ttll3 A G 6: 113,394,998 E73G probably damaging Het
Vmn1r194 A G 13: 22,245,077 N288S probably benign Het
Other mutations in Gpr37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Gpr37 APN 6 25669318 missense possibly damaging 0.65
IGL01595:Gpr37 APN 6 25669573 missense probably damaging 1.00
IGL01670:Gpr37 APN 6 25669834 missense probably damaging 1.00
IGL02552:Gpr37 APN 6 25688687 missense probably benign 0.05
IGL03331:Gpr37 APN 6 25669729 missense probably benign 0.26
R0375:Gpr37 UTSW 6 25669291 missense probably benign 0.08
R0534:Gpr37 UTSW 6 25669824 nonsense probably null
R0892:Gpr37 UTSW 6 25688207 missense probably damaging 1.00
R1481:Gpr37 UTSW 6 25669138 missense probably damaging 0.99
R1700:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R2083:Gpr37 UTSW 6 25688417 missense possibly damaging 0.62
R2089:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2091:Gpr37 UTSW 6 25689063 missense possibly damaging 0.73
R2112:Gpr37 UTSW 6 25669381 missense possibly damaging 0.91
R2847:Gpr37 UTSW 6 25666946 unclassified probably benign
R2848:Gpr37 UTSW 6 25666946 unclassified probably benign
R4119:Gpr37 UTSW 6 25688426 missense possibly damaging 0.90
R4611:Gpr37 UTSW 6 25669624 missense probably benign 0.09
R4734:Gpr37 UTSW 6 25689086 missense possibly damaging 0.53
R4765:Gpr37 UTSW 6 25669108 missense probably damaging 1.00
R5163:Gpr37 UTSW 6 25669615 missense possibly damaging 0.87
R5669:Gpr37 UTSW 6 25669352 missense probably benign 0.05
R6548:Gpr37 UTSW 6 25688813 missense probably benign 0.32
R6760:Gpr37 UTSW 6 25669169 missense probably benign 0.00
R7030:Gpr37 UTSW 6 25689005 missense possibly damaging 0.92
R7278:Gpr37 UTSW 6 25669342 missense possibly damaging 0.68
R7392:Gpr37 UTSW 6 25688787 missense probably benign 0.34
R7726:Gpr37 UTSW 6 25669117 missense possibly damaging 0.94
R7754:Gpr37 UTSW 6 25689050 missense probably damaging 0.99
R7757:Gpr37 UTSW 6 25688208 missense probably benign 0.26
R8734:Gpr37 UTSW 6 25688202 missense probably benign 0.17
R8839:Gpr37 UTSW 6 25669370 missense probably benign 0.15
V7732:Gpr37 UTSW 6 25669123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCAGTGACAATGTTGCAG -3'
(R):5'- CAAACTTGCCGTTATCTGGG -3'

Sequencing Primer
(F):5'- GACAATGTTGCAGATATTCTCAGGG -3'
(R):5'- GGAGCTCTGCTTTTGGCCC -3'
Posted On 2020-09-02