Incidental Mutation 'R8344:Ttll3'
ID 645089
Institutional Source Beutler Lab
Gene Symbol Ttll3
Ensembl Gene ENSMUSG00000030276
Gene Name tubulin tyrosine ligase-like family, member 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8344 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 113389260-113414587 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113394998 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 73 (E73G)
Ref Sequence ENSEMBL: ENSMUSP00000145049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032414] [ENSMUST00000038889] [ENSMUST00000156898] [ENSMUST00000204026] [ENSMUST00000205017]
AlphaFold A4Q9E5
Predicted Effect probably benign
Transcript: ENSMUST00000032414
AA Change: E221G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000032414
Gene: ENSMUSG00000030276
AA Change: E221G

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 698 7.7e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000038889
AA Change: E221G

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037870
Gene: ENSMUSG00000030276
AA Change: E221G

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 214 231 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
Pfam:TTL 404 699 9e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156898
SMART Domains Protein: ENSMUSP00000114839
Gene: ENSMUSG00000079426

DomainStartEndE-ValueType
Pfam:ARPC4 1 167 8.3e-88 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000204026
AA Change: E73G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145049
Gene: ENSMUSG00000030276
AA Change: E73G

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205017
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduced number of primary cilia in colon epithelia accompanied by an increased rate of cell division which is compensated by faster tissue turnover in the colon. Mice exhibit increased incidence of colon tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,911,119 Y83F possibly damaging Het
Adgre1 C G 17: 57,408,459 Q260E probably benign Het
Adgrf4 T A 17: 42,666,908 M515L probably benign Het
Adgrl2 A T 3: 148,859,525 C140S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Ampd1 A T 3: 103,095,686 E573V possibly damaging Het
Atxn7l3b T A 10: 112,928,662 I21F possibly damaging Het
Bckdha C T 7: 25,631,447 R298H probably damaging Het
Cacng3 A C 7: 122,768,346 I150L possibly damaging Het
Ccdc18 A T 5: 108,161,503 K321N possibly damaging Het
Ccl11 A T 11: 82,061,742 K47M possibly damaging Het
Cdkn2a T C 4: 89,276,750 I142M probably benign Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Chrna1 C A 2: 73,570,609 E192D probably benign Het
Clasp1 A G 1: 118,503,899 N420D probably damaging Het
Clca3a2 T A 3: 144,805,942 probably null Het
Cntn2 T C 1: 132,521,774 Y643C probably damaging Het
Dcun1d1 G A 3: 35,897,554 H204Y probably benign Het
Dlg2 A T 7: 92,438,014 Q767L possibly damaging Het
Dnah11 A G 12: 118,085,731 S1653P probably benign Het
Dvl3 T A 16: 20,523,763 probably null Het
Egf T C 3: 129,754,943 T8A unknown Het
Eln G T 5: 134,728,392 T219K unknown Het
Evc T C 5: 37,314,528 D536G possibly damaging Het
Fbxo3 A G 2: 104,051,208 E295G possibly damaging Het
Gm14548 T A 7: 3,896,955 E216V possibly damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gpr37 A G 6: 25,669,531 F438S probably damaging Het
Gsk3b T C 16: 38,191,625 S236P probably benign Het
Kdm5d A G Y: 942,477 T1381A probably benign Het
Klhl12 T C 1: 134,485,722 I315T possibly damaging Het
Ltb T A 17: 35,195,193 N102K probably benign Het
Macf1 C A 4: 123,384,683 D5993Y probably damaging Het
Macf1 T C 4: 123,526,856 T202A probably benign Het
Mak T A 13: 41,046,203 D320V probably benign Het
Map2 G A 1: 66,421,713 R1556H probably damaging Het
Mgat4d G T 8: 83,368,133 M266I probably benign Het
Mmp24 G T 2: 155,810,303 R310S possibly damaging Het
Myh6 A T 14: 54,953,434 L928Q probably damaging Het
Npnt A G 3: 132,908,456 L179P probably damaging Het
Olfr1205 A G 2: 88,831,383 I89V probably benign Het
Olfr38 A G 6: 42,762,565 N171S probably benign Het
Olfr972 T G 9: 39,873,935 F220C probably benign Het
Parp4 A T 14: 56,648,729 Y1755F unknown Het
Phactr1 A G 13: 42,709,821 E74G possibly damaging Het
Plcg1 G A 2: 160,747,896 M113I probably benign Het
Plekhh2 T G 17: 84,571,761 S638A possibly damaging Het
Ppp2r3a T A 9: 101,211,786 H446L probably benign Het
Prkcg G T 7: 3,330,170 D644Y probably damaging Het
Rbbp8nl G T 2: 180,279,713 R293S probably benign Het
Rbl2 A T 8: 91,115,759 H1057L possibly damaging Het
Rpgrip1 A T 14: 52,150,362 H1076L possibly damaging Het
Scn11a A C 9: 119,781,970 D938E probably benign Het
Sec24b T C 3: 130,005,001 D573G probably damaging Het
Serpinf1 T G 11: 75,415,571 Q147P unknown Het
Skint6 C T 4: 113,236,445 G167D probably damaging Het
Slc15a5 A G 6: 138,079,900 F6S probably damaging Het
Smc2 T A 4: 52,449,376 I179K probably benign Het
Smpdl3a A G 10: 57,800,977 K57R possibly damaging Het
Smpdl3b T A 4: 132,746,679 H25L probably damaging Het
Srpk1 T C 17: 28,620,424 D35G unknown Het
Strn A G 17: 78,672,647 V324A probably damaging Het
Sult6b2 T C 6: 142,790,296 K191E probably benign Het
Tmem168 A G 6: 13,583,325 I519T probably benign Het
Tmem41a T C 16: 21,938,034 T112A probably benign Het
Tmem67 A G 4: 12,058,576 I507T probably benign Het
Tns1 T C 1: 73,985,042 E454G probably damaging Het
Trim26 C A 17: 36,857,710 D422E unknown Het
Triobp C A 15: 78,958,275 R58S possibly damaging Het
Trp53 T C 11: 69,587,583 F106S probably damaging Het
Tshz3 C A 7: 36,771,537 Q984K probably damaging Het
Vmn1r194 A G 13: 22,245,077 N288S probably benign Het
Other mutations in Ttll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Ttll3 APN 6 113394729 missense probably damaging 1.00
IGL01677:Ttll3 APN 6 113412984 missense probably benign
IGL01697:Ttll3 APN 6 113399729 missense probably benign 0.00
IGL01944:Ttll3 APN 6 113414115 missense probably benign
IGL02688:Ttll3 APN 6 113399739 missense probably benign 0.00
IGL03068:Ttll3 APN 6 113409197 missense probably damaging 1.00
R0373:Ttll3 UTSW 6 113398777 missense probably damaging 1.00
R0472:Ttll3 UTSW 6 113409339 missense probably damaging 1.00
R0625:Ttll3 UTSW 6 113408903 critical splice acceptor site probably null
R1868:Ttll3 UTSW 6 113392764 missense possibly damaging 0.95
R2026:Ttll3 UTSW 6 113398770 missense probably damaging 1.00
R2061:Ttll3 UTSW 6 113409042 missense possibly damaging 0.76
R2128:Ttll3 UTSW 6 113412934 missense probably benign 0.31
R2896:Ttll3 UTSW 6 113392722 missense probably benign 0.15
R2903:Ttll3 UTSW 6 113407323 missense probably damaging 0.99
R2906:Ttll3 UTSW 6 113392510 unclassified probably benign
R4659:Ttll3 UTSW 6 113414141 missense probably benign
R4746:Ttll3 UTSW 6 113407392 missense probably damaging 1.00
R4984:Ttll3 UTSW 6 113412940 missense probably benign 0.00
R5358:Ttll3 UTSW 6 113401331 missense probably benign 0.26
R5372:Ttll3 UTSW 6 113401421 nonsense probably null
R5525:Ttll3 UTSW 6 113412978 missense probably benign
R5548:Ttll3 UTSW 6 113393117 missense probably damaging 1.00
R5694:Ttll3 UTSW 6 113399708 missense probably damaging 1.00
R5993:Ttll3 UTSW 6 113398031 nonsense probably null
R6119:Ttll3 UTSW 6 113394741 missense probably damaging 1.00
R6268:Ttll3 UTSW 6 113392563 missense probably benign 0.00
R6719:Ttll3 UTSW 6 113399032 intron probably benign
R6852:Ttll3 UTSW 6 113399155 frame shift probably null
R6852:Ttll3 UTSW 6 113399157 frame shift probably null
R6852:Ttll3 UTSW 6 113399159 frame shift probably null
R6853:Ttll3 UTSW 6 113399157 frame shift probably null
R6854:Ttll3 UTSW 6 113399157 frame shift probably null
R7170:Ttll3 UTSW 6 113413878 missense probably benign 0.41
R7239:Ttll3 UTSW 6 113399157 frame shift probably null
R7302:Ttll3 UTSW 6 113409285 missense probably damaging 1.00
R7330:Ttll3 UTSW 6 113399157 frame shift probably null
R7330:Ttll3 UTSW 6 113399164 frame shift probably null
R7586:Ttll3 UTSW 6 113399157 frame shift probably null
R7587:Ttll3 UTSW 6 113399157 frame shift probably null
R7701:Ttll3 UTSW 6 113399157 frame shift probably null
R7702:Ttll3 UTSW 6 113399157 frame shift probably null
R7776:Ttll3 UTSW 6 113399159 frame shift probably null
R7793:Ttll3 UTSW 6 113399159 frame shift probably null
R7797:Ttll3 UTSW 6 113394777 missense possibly damaging 0.76
R7824:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399157 frame shift probably null
R7825:Ttll3 UTSW 6 113399159 frame shift probably null
R7826:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399157 frame shift probably null
R7827:Ttll3 UTSW 6 113399162 frame shift probably null
R7831:Ttll3 UTSW 6 113399157 frame shift probably null
R7832:Ttll3 UTSW 6 113399157 frame shift probably null
R7833:Ttll3 UTSW 6 113409337 missense probably damaging 1.00
R7966:Ttll3 UTSW 6 113399157 frame shift probably null
R8418:Ttll3 UTSW 6 113394773 missense probably benign 0.04
R8768:Ttll3 UTSW 6 113408988 missense probably damaging 1.00
R9017:Ttll3 UTSW 6 113412889 missense probably benign 0.00
R9036:Ttll3 UTSW 6 113399696 missense possibly damaging 0.47
R9090:Ttll3 UTSW 6 113392635 missense probably benign
R9271:Ttll3 UTSW 6 113392635 missense probably benign
R9329:Ttll3 UTSW 6 113392674 missense probably benign
R9532:Ttll3 UTSW 6 113409009 missense possibly damaging 0.69
R9535:Ttll3 UTSW 6 113412873 missense probably damaging 1.00
R9725:Ttll3 UTSW 6 113409153 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCTGGGTGATAGCGATG -3'
(R):5'- AGAAGCAGTCTGTTTTCTCAAGAC -3'

Sequencing Primer
(F):5'- TGGGTGATAGCGATGCCACG -3'
(R):5'- CAGTCTGTTTTCTCAAGACTGGAAGC -3'
Posted On 2020-09-02