Incidental Mutation 'R0030:Agap1'
ID64509
Institutional Source Beutler Lab
Gene Symbol Agap1
Ensembl Gene ENSMUSG00000055013
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 1
SynonymsGgap1, Centg2
MMRRC Submission 038324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0030 (G1)
Quality Score107
Status Not validated
Chromosome1
Chromosomal Location89454806-89897617 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 89888744 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 755 (Y755*)
Ref Sequence ENSEMBL: ENSMUSP00000140599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096]
Predicted Effect probably null
Transcript: ENSMUST00000027521
AA Change: Y808*
SMART Domains Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: Y808*

DomainStartEndE-ValueType
Pfam:Ras 73 231 1.1e-18 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 590 1.36e-15 SMART
ArfGap 609 729 4.58e-51 SMART
ANK 768 797 1.83e-3 SMART
ANK 801 832 1.33e2 SMART
low complexity region 840 852 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000074945
AA Change: Y621*
SMART Domains Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013
AA Change: Y621*

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190096
AA Change: Y755*
SMART Domains Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: Y755*

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G A 1: 179,752,436 T2067M probably damaging Het
Ank1 C A 8: 23,093,893 D337E probably damaging Het
Ankrd65 A C 4: 155,791,485 R72S probably damaging Het
Cacna1s T C 1: 136,094,989 probably null Het
Cyp4f40 T C 17: 32,675,973 S462P probably damaging Het
Dxo A G 17: 34,837,938 R132G probably damaging Het
Eps15l1 A G 8: 72,373,050 S646P probably benign Het
Foxi2 A G 7: 135,411,616 T192A probably damaging Het
Fry T A 5: 150,372,569 C480* probably null Het
Gak C T 5: 108,613,547 W206* probably null Het
Ggt7 G T 2: 155,506,488 D5E probably benign Het
Hectd4 G T 5: 121,262,588 G339* probably null Het
Ikzf3 T C 11: 98,467,612 T300A probably benign Het
Med12l T G 3: 59,248,655 L1198R probably damaging Het
Odf4 T A 11: 68,926,941 E9D probably benign Het
Olfr1395 T A 11: 49,149,040 M261K possibly damaging Het
Pax1 C A 2: 147,368,582 F412L probably damaging Het
Polg A T 7: 79,452,128 I1006N probably damaging Het
Ppp4c A G 7: 126,788,433 V51A possibly damaging Het
Scn10a G C 9: 119,669,990 T304R probably benign Het
Scp2 T A 4: 108,107,690 probably null Het
Ubr4 G T 4: 139,426,793 V2104L probably damaging Het
Other mutations in Agap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Agap1 APN 1 89663796 splice site probably benign
IGL00310:Agap1 APN 1 89887670 missense probably damaging 1.00
IGL01104:Agap1 APN 1 89726075 splice site probably benign
IGL02227:Agap1 APN 1 89663775 missense probably damaging 0.99
IGL02959:Agap1 APN 1 89843191 missense possibly damaging 0.94
IGL03303:Agap1 APN 1 89665152 missense probably damaging 1.00
K3955:Agap1 UTSW 1 89887604 missense probably damaging 1.00
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0400:Agap1 UTSW 1 89843250 splice site probably benign
R1104:Agap1 UTSW 1 89789240 missense probably damaging 0.99
R1160:Agap1 UTSW 1 89843154 missense probably damaging 0.98
R1439:Agap1 UTSW 1 89843186 missense probably damaging 1.00
R1454:Agap1 UTSW 1 89837806 splice site probably null
R1644:Agap1 UTSW 1 89663730 missense probably damaging 0.97
R1984:Agap1 UTSW 1 89766323 missense probably benign
R2141:Agap1 UTSW 1 89837755 missense probably damaging 0.99
R3966:Agap1 UTSW 1 89834461 missense probably damaging 0.99
R4195:Agap1 UTSW 1 89834539 missense probably damaging 0.99
R4669:Agap1 UTSW 1 89837806 splice site probably null
R4951:Agap1 UTSW 1 89609503 missense probably damaging 1.00
R5525:Agap1 UTSW 1 89743773 missense possibly damaging 0.86
R5843:Agap1 UTSW 1 89609550 missense probably damaging 0.97
R5930:Agap1 UTSW 1 89843096 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6879:Agap1 UTSW 1 89766455 missense probably benign 0.25
R7027:Agap1 UTSW 1 89888722 missense probably benign 0.00
R7207:Agap1 UTSW 1 89843099 missense possibly damaging 0.91
R7268:Agap1 UTSW 1 89766348 missense probably benign 0.02
R7289:Agap1 UTSW 1 89455431 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- AGCCAACTTGAAGTCCTCTTTGACC -3'
(R):5'- TCGTGTGCTATCCTCAAAGCCG -3'

Sequencing Primer
(F):5'- GGTTCAGAGCCTGGTCTAAAC -3'
(R):5'- AAAGAGTTCCGTCCTGTGGC -3'
Posted On2013-08-06