Incidental Mutation 'R8344:Slc15a5'
ID645090
Institutional Source Beutler Lab
Gene Symbol Slc15a5
Ensembl Gene ENSMUSG00000044378
Gene Namesolute carrier family 15, member 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8344 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location137983586-138079916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138079900 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 6 (F6S)
Ref Sequence ENSEMBL: ENSMUSP00000129239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171804]
Predicted Effect probably damaging
Transcript: ENSMUST00000171804
AA Change: F6S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129239
Gene: ENSMUSG00000044378
AA Change: F6S

DomainStartEndE-ValueType
Pfam:PTR2 101 485 4.3e-23 PFAM
low complexity region 536 543 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,911,119 Y83F possibly damaging Het
Adgre1 C G 17: 57,408,459 Q260E probably benign Het
Adgrf4 T A 17: 42,666,908 M515L probably benign Het
Adgrl2 A T 3: 148,859,525 C140S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Ampd1 A T 3: 103,095,686 E573V possibly damaging Het
Atxn7l3b T A 10: 112,928,662 I21F possibly damaging Het
Bckdha C T 7: 25,631,447 R298H probably damaging Het
Cacng3 A C 7: 122,768,346 I150L possibly damaging Het
Ccdc18 A T 5: 108,161,503 K321N possibly damaging Het
Ccl11 A T 11: 82,061,742 K47M possibly damaging Het
Cdkn2a T C 4: 89,276,750 I142M probably benign Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Chrna1 C A 2: 73,570,609 E192D probably benign Het
Clasp1 A G 1: 118,503,899 N420D probably damaging Het
Clca3a2 T A 3: 144,805,942 probably null Het
Cntn2 T C 1: 132,521,774 Y643C probably damaging Het
Dcun1d1 G A 3: 35,897,554 H204Y probably benign Het
Dlg2 A T 7: 92,438,014 Q767L possibly damaging Het
Dnah11 A G 12: 118,085,731 S1653P probably benign Het
Dvl3 T A 16: 20,523,763 probably null Het
Egf T C 3: 129,754,943 T8A unknown Het
Eln G T 5: 134,728,392 T219K unknown Het
Evc T C 5: 37,314,528 D536G possibly damaging Het
Fbxo3 A G 2: 104,051,208 E295G possibly damaging Het
Gm14548 T A 7: 3,896,955 E216V possibly damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gpr37 A G 6: 25,669,531 F438S probably damaging Het
Gsk3b T C 16: 38,191,625 S236P probably benign Het
Kdm5d A G Y: 942,477 T1381A probably benign Het
Klhl12 T C 1: 134,485,722 I315T possibly damaging Het
Ltb T A 17: 35,195,193 N102K probably benign Het
Macf1 C A 4: 123,384,683 D5993Y probably damaging Het
Macf1 T C 4: 123,526,856 T202A probably benign Het
Mak T A 13: 41,046,203 D320V probably benign Het
Map2 G A 1: 66,421,713 R1556H probably damaging Het
Mgat4d G T 8: 83,368,133 M266I probably benign Het
Mmp24 G T 2: 155,810,303 R310S possibly damaging Het
Myh6 A T 14: 54,953,434 L928Q probably damaging Het
Npnt A G 3: 132,908,456 L179P probably damaging Het
Olfr1205 A G 2: 88,831,383 I89V probably benign Het
Olfr38 A G 6: 42,762,565 N171S probably benign Het
Olfr972 T G 9: 39,873,935 F220C probably benign Het
Parp4 A T 14: 56,648,729 Y1755F unknown Het
Phactr1 A G 13: 42,709,821 E74G possibly damaging Het
Plcg1 G A 2: 160,747,896 M113I probably benign Het
Plekhh2 T G 17: 84,571,761 S638A possibly damaging Het
Ppp2r3a T A 9: 101,211,786 H446L probably benign Het
Prkcg G T 7: 3,330,170 D644Y probably damaging Het
Rbbp8nl G T 2: 180,279,713 R293S probably benign Het
Rbl2 A T 8: 91,115,759 H1057L possibly damaging Het
Rpgrip1 A T 14: 52,150,362 H1076L possibly damaging Het
Scn11a A C 9: 119,781,970 D938E probably benign Het
Sec24b T C 3: 130,005,001 D573G probably damaging Het
Serpinf1 T G 11: 75,415,571 Q147P unknown Het
Skint6 C T 4: 113,236,445 G167D probably damaging Het
Smc2 T A 4: 52,449,376 I179K probably benign Het
Smpdl3a A G 10: 57,800,977 K57R possibly damaging Het
Smpdl3b T A 4: 132,746,679 H25L probably damaging Het
Srpk1 T C 17: 28,620,424 D35G unknown Het
Strn A G 17: 78,672,647 V324A probably damaging Het
Sult6b2 T C 6: 142,790,296 K191E probably benign Het
Tmem168 A G 6: 13,583,325 I519T probably benign Het
Tmem41a T C 16: 21,938,034 T112A probably benign Het
Tmem67 A G 4: 12,058,576 I507T probably benign Het
Tns1 T C 1: 73,985,042 E454G probably damaging Het
Trim26 C A 17: 36,857,710 D422E unknown Het
Triobp C A 15: 78,958,275 R58S possibly damaging Het
Trp53 T C 11: 69,587,583 F106S probably damaging Het
Tshz3 C A 7: 36,771,537 Q984K probably damaging Het
Ttll3 A G 6: 113,394,998 E73G probably damaging Het
Vmn1r194 A G 13: 22,245,077 N288S probably benign Het
Other mutations in Slc15a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Slc15a5 APN 6 138043538 missense probably damaging 1.00
IGL02090:Slc15a5 APN 6 138043600 missense probably benign 0.00
R0288:Slc15a5 UTSW 6 138017916 splice site probably benign
R0355:Slc15a5 UTSW 6 138018114 splice site probably benign
R0825:Slc15a5 UTSW 6 138018089 missense possibly damaging 0.84
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1721:Slc15a5 UTSW 6 138072847 splice site probably benign
R1897:Slc15a5 UTSW 6 138079764 missense possibly damaging 0.93
R4159:Slc15a5 UTSW 6 138072940 missense possibly damaging 0.84
R4415:Slc15a5 UTSW 6 138079756 missense probably benign 0.34
R4703:Slc15a5 UTSW 6 138055645 missense probably benign 0.08
R4951:Slc15a5 UTSW 6 138073066 missense probably damaging 1.00
R4996:Slc15a5 UTSW 6 138043585 missense probably damaging 1.00
R5268:Slc15a5 UTSW 6 138079753 missense probably damaging 1.00
R5310:Slc15a5 UTSW 6 138073036 missense probably benign 0.28
R5321:Slc15a5 UTSW 6 137987438 missense probably benign 0.08
R5963:Slc15a5 UTSW 6 138079693 missense probably damaging 1.00
R5988:Slc15a5 UTSW 6 138043531 missense probably benign 0.07
R7400:Slc15a5 UTSW 6 138073057 missense probably benign 0.01
R7515:Slc15a5 UTSW 6 138043498 missense possibly damaging 0.89
R7604:Slc15a5 UTSW 6 138079786 missense probably damaging 1.00
R7707:Slc15a5 UTSW 6 138079747 missense probably damaging 1.00
R8410:Slc15a5 UTSW 6 138012155 missense
Z1188:Slc15a5 UTSW 6 138017958 missense
Predicted Primers PCR Primer
(F):5'- CAAGCCTCCCTGTGCAAAAG -3'
(R):5'- GAGTGTTTAAATGCTCAGGTCTTC -3'

Sequencing Primer
(F):5'- CCTGTGCAAAAGGGGATCATGTTG -3'
(R):5'- GGTCCAAGCAACTCACAT -3'
Posted On2020-09-02