Incidental Mutation 'R8344:Gp2'
ID645097
Institutional Source Beutler Lab
Gene Symbol Gp2
Ensembl Gene ENSMUSG00000030954
Gene Nameglycoprotein 2 (zymogen granule membrane)
Synonyms2310037I18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8344 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119442537-119459285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119442787 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 505 (C505Y)
Ref Sequence ENSEMBL: ENSMUSP00000146487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033255] [ENSMUST00000207887]
Predicted Effect silent
Transcript: ENSMUST00000033255
SMART Domains Protein: ENSMUSP00000033255
Gene: ENSMUSG00000030954

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:ZP 164 213 1e-11 BLAST
ZP 225 477 5.39e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207887
AA Change: C505Y

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is secreted from intracellular zymogen granules and associates with the plasma membrane via glycosylphosphatidylinositol (GPI) linkage. The encoded protein binds pathogens such as enterobacteria, thereby playing an important role in the innate immune response. The C-terminus of this protein is related to the C-terminus of the protein encoded by the neighboring gene, uromodulin (UMOD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mice display no obvious abnormalities in pancreas morphology and function, development, growth, weight, behavior, life span, or fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,911,119 Y83F possibly damaging Het
Adgre1 C G 17: 57,408,459 Q260E probably benign Het
Adgrf4 T A 17: 42,666,908 M515L probably benign Het
Adgrl2 A T 3: 148,859,525 C140S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Ampd1 A T 3: 103,095,686 E573V possibly damaging Het
Atxn7l3b T A 10: 112,928,662 I21F possibly damaging Het
Bckdha C T 7: 25,631,447 R298H probably damaging Het
Cacng3 A C 7: 122,768,346 I150L possibly damaging Het
Ccdc18 A T 5: 108,161,503 K321N possibly damaging Het
Ccl11 A T 11: 82,061,742 K47M possibly damaging Het
Cdkn2a T C 4: 89,276,750 I142M probably benign Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Chrna1 C A 2: 73,570,609 E192D probably benign Het
Clasp1 A G 1: 118,503,899 N420D probably damaging Het
Clca3a2 T A 3: 144,805,942 probably null Het
Cntn2 T C 1: 132,521,774 Y643C probably damaging Het
Dcun1d1 G A 3: 35,897,554 H204Y probably benign Het
Dlg2 A T 7: 92,438,014 Q767L possibly damaging Het
Dnah11 A G 12: 118,085,731 S1653P probably benign Het
Dvl3 T A 16: 20,523,763 probably null Het
Egf T C 3: 129,754,943 T8A unknown Het
Eln G T 5: 134,728,392 T219K unknown Het
Evc T C 5: 37,314,528 D536G possibly damaging Het
Fbxo3 A G 2: 104,051,208 E295G possibly damaging Het
Gm14548 T A 7: 3,896,955 E216V possibly damaging Het
Gpr37 A G 6: 25,669,531 F438S probably damaging Het
Gsk3b T C 16: 38,191,625 S236P probably benign Het
Kdm5d A G Y: 942,477 T1381A probably benign Het
Klhl12 T C 1: 134,485,722 I315T possibly damaging Het
Ltb T A 17: 35,195,193 N102K probably benign Het
Macf1 C A 4: 123,384,683 D5993Y probably damaging Het
Macf1 T C 4: 123,526,856 T202A probably benign Het
Mak T A 13: 41,046,203 D320V probably benign Het
Map2 G A 1: 66,421,713 R1556H probably damaging Het
Mgat4d G T 8: 83,368,133 M266I probably benign Het
Mmp24 G T 2: 155,810,303 R310S possibly damaging Het
Myh6 A T 14: 54,953,434 L928Q probably damaging Het
Npnt A G 3: 132,908,456 L179P probably damaging Het
Olfr1205 A G 2: 88,831,383 I89V probably benign Het
Olfr38 A G 6: 42,762,565 N171S probably benign Het
Olfr972 T G 9: 39,873,935 F220C probably benign Het
Parp4 A T 14: 56,648,729 Y1755F unknown Het
Phactr1 A G 13: 42,709,821 E74G possibly damaging Het
Plcg1 G A 2: 160,747,896 M113I probably benign Het
Plekhh2 T G 17: 84,571,761 S638A possibly damaging Het
Ppp2r3a T A 9: 101,211,786 H446L probably benign Het
Prkcg G T 7: 3,330,170 D644Y probably damaging Het
Rbbp8nl G T 2: 180,279,713 R293S probably benign Het
Rbl2 A T 8: 91,115,759 H1057L possibly damaging Het
Rpgrip1 A T 14: 52,150,362 H1076L possibly damaging Het
Scn11a A C 9: 119,781,970 D938E probably benign Het
Sec24b T C 3: 130,005,001 D573G probably damaging Het
Serpinf1 T G 11: 75,415,571 Q147P unknown Het
Skint6 C T 4: 113,236,445 G167D probably damaging Het
Slc15a5 A G 6: 138,079,900 F6S probably damaging Het
Smc2 T A 4: 52,449,376 I179K probably benign Het
Smpdl3a A G 10: 57,800,977 K57R possibly damaging Het
Smpdl3b T A 4: 132,746,679 H25L probably damaging Het
Srpk1 T C 17: 28,620,424 D35G unknown Het
Strn A G 17: 78,672,647 V324A probably damaging Het
Sult6b2 T C 6: 142,790,296 K191E probably benign Het
Tmem168 A G 6: 13,583,325 I519T probably benign Het
Tmem41a T C 16: 21,938,034 T112A probably benign Het
Tmem67 A G 4: 12,058,576 I507T probably benign Het
Tns1 T C 1: 73,985,042 E454G probably damaging Het
Trim26 C A 17: 36,857,710 D422E unknown Het
Triobp C A 15: 78,958,275 R58S possibly damaging Het
Trp53 T C 11: 69,587,583 F106S probably damaging Het
Tshz3 C A 7: 36,771,537 Q984K probably damaging Het
Ttll3 A G 6: 113,394,998 E73G probably damaging Het
Vmn1r194 A G 13: 22,245,077 N288S probably benign Het
Other mutations in Gp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Gp2 APN 7 119454390 missense probably damaging 0.96
IGL00818:Gp2 APN 7 119450127 missense possibly damaging 0.82
IGL01830:Gp2 APN 7 119451542 missense probably damaging 1.00
IGL02088:Gp2 APN 7 119454469 missense probably damaging 1.00
IGL02284:Gp2 APN 7 119450183 missense probably damaging 1.00
IGL02812:Gp2 APN 7 119452229 missense probably benign 0.01
IGL03049:Gp2 APN 7 119450294 missense possibly damaging 0.82
IGL03368:Gp2 APN 7 119452874 missense probably damaging 1.00
IGL03369:Gp2 APN 7 119451560 missense probably damaging 0.98
PIT4687001:Gp2 UTSW 7 119451578 missense possibly damaging 0.48
R0179:Gp2 UTSW 7 119452317 missense possibly damaging 0.81
R0367:Gp2 UTSW 7 119454568 missense probably damaging 1.00
R0544:Gp2 UTSW 7 119454496 missense probably benign 0.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0973:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R0974:Gp2 UTSW 7 119454543 missense probably damaging 1.00
R1413:Gp2 UTSW 7 119451630 missense probably benign 0.15
R1557:Gp2 UTSW 7 119450079 missense probably damaging 1.00
R1638:Gp2 UTSW 7 119451498 critical splice donor site probably null
R1709:Gp2 UTSW 7 119451585 missense probably null 1.00
R1932:Gp2 UTSW 7 119454232 missense possibly damaging 0.81
R2109:Gp2 UTSW 7 119452932 missense probably benign
R2159:Gp2 UTSW 7 119452284 missense probably benign 0.06
R2285:Gp2 UTSW 7 119450085 missense possibly damaging 0.82
R4657:Gp2 UTSW 7 119457168 missense probably benign 0.38
R4829:Gp2 UTSW 7 119457184 missense possibly damaging 0.56
R4854:Gp2 UTSW 7 119452199 missense possibly damaging 0.72
R4927:Gp2 UTSW 7 119452895 missense probably benign 0.00
R5022:Gp2 UTSW 7 119449114 missense probably damaging 1.00
R5033:Gp2 UTSW 7 119454291 missense probably damaging 0.99
R5443:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5444:Gp2 UTSW 7 119454598 missense possibly damaging 0.60
R5681:Gp2 UTSW 7 119452294 missense possibly damaging 0.92
R5732:Gp2 UTSW 7 119449108 missense probably damaging 1.00
R5964:Gp2 UTSW 7 119449129 missense probably benign 0.02
R6963:Gp2 UTSW 7 119452897 missense probably benign 0.03
R7014:Gp2 UTSW 7 119451645 missense probably damaging 1.00
R7087:Gp2 UTSW 7 119450232 missense probably damaging 0.99
R7223:Gp2 UTSW 7 119451498 critical splice donor site probably null
R7497:Gp2 UTSW 7 119454606 missense probably damaging 1.00
R8165:Gp2 UTSW 7 119450152 missense probably damaging 1.00
R8343:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8345:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8431:Gp2 UTSW 7 119442787 missense probably benign 0.01
R8432:Gp2 UTSW 7 119442787 missense probably benign 0.01
X0026:Gp2 UTSW 7 119442819 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTCAGAACAAGAGGCATTTTGAAAG -3'
(R):5'- AAGCAGTTGTTGTCCCAAAC -3'

Sequencing Primer
(F):5'- TGAAAGGATCATGGGATTTGCCC -3'
(R):5'- GGTACTTCTGCAGCAAGT -3'
Posted On2020-09-02