Incidental Mutation 'R8344:Triobp'
ID 645116
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8344 (G1)
Quality Score 224.009
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78842475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 58 (R58S)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229943]
AlphaFold Q99KW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109689
AA Change: R58S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: R58S

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: R58S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: R58S

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140228
AA Change: R58S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000229943
AA Change: R58S

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,888,519 (GRCm39) Y83F possibly damaging Het
Adgre1 C G 17: 57,715,459 (GRCm39) Q260E probably benign Het
Adgrf4 T A 17: 42,977,799 (GRCm39) M515L probably benign Het
Adgrl2 A T 3: 148,565,161 (GRCm39) C140S probably damaging Het
Ago3 T A 4: 126,270,721 (GRCm39) K258* probably null Het
Ampd1 A T 3: 103,003,002 (GRCm39) E573V possibly damaging Het
Atxn7l3b T A 10: 112,764,567 (GRCm39) I21F possibly damaging Het
Bckdha C T 7: 25,330,872 (GRCm39) R298H probably damaging Het
Cacng3 A C 7: 122,367,569 (GRCm39) I150L possibly damaging Het
Ccdc18 A T 5: 108,309,369 (GRCm39) K321N possibly damaging Het
Ccl11 A T 11: 81,952,568 (GRCm39) K47M possibly damaging Het
Cdkn2a T C 4: 89,194,987 (GRCm39) I142M probably benign Het
Cfap65 C T 1: 74,967,203 (GRCm39) G249R probably benign Het
Chrna1 C A 2: 73,400,953 (GRCm39) E192D probably benign Het
Clasp1 A G 1: 118,431,629 (GRCm39) N420D probably damaging Het
Clca3a2 T A 3: 144,511,703 (GRCm39) probably null Het
Cntn2 T C 1: 132,449,512 (GRCm39) Y643C probably damaging Het
Dcun1d1 G A 3: 35,951,703 (GRCm39) H204Y probably benign Het
Dlg2 A T 7: 92,087,222 (GRCm39) Q767L possibly damaging Het
Dnah11 A G 12: 118,049,466 (GRCm39) S1653P probably benign Het
Dvl3 T A 16: 20,342,513 (GRCm39) probably null Het
Egf T C 3: 129,548,592 (GRCm39) T8A unknown Het
Eln G T 5: 134,757,246 (GRCm39) T219K unknown Het
Evc T C 5: 37,471,872 (GRCm39) D536G possibly damaging Het
Fbxo3 A G 2: 103,881,553 (GRCm39) E295G possibly damaging Het
Gp2 C T 7: 119,042,010 (GRCm39) C505Y probably benign Het
Gpr37 A G 6: 25,669,530 (GRCm39) F438S probably damaging Het
Gsk3b T C 16: 38,011,987 (GRCm39) S236P probably benign Het
Kdm5d A G Y: 942,477 (GRCm39) T1381A probably benign Het
Klhl12 T C 1: 134,413,460 (GRCm39) I315T possibly damaging Het
Ltb T A 17: 35,414,169 (GRCm39) N102K probably benign Het
Macf1 T C 4: 123,420,649 (GRCm39) T202A probably benign Het
Macf1 C A 4: 123,278,476 (GRCm39) D5993Y probably damaging Het
Mak T A 13: 41,199,679 (GRCm39) D320V probably benign Het
Map2 G A 1: 66,460,872 (GRCm39) R1556H probably damaging Het
Mgat4d G T 8: 84,094,762 (GRCm39) M266I probably benign Het
Mmp24 G T 2: 155,652,223 (GRCm39) R310S possibly damaging Het
Myh6 A T 14: 55,190,891 (GRCm39) L928Q probably damaging Het
Npnt A G 3: 132,614,217 (GRCm39) L179P probably damaging Het
Or2f1b A G 6: 42,739,499 (GRCm39) N171S probably benign Het
Or4c11c A G 2: 88,661,727 (GRCm39) I89V probably benign Het
Or8g55 T G 9: 39,785,231 (GRCm39) F220C probably benign Het
Parp4 A T 14: 56,886,186 (GRCm39) Y1755F unknown Het
Phactr1 A G 13: 42,863,297 (GRCm39) E74G possibly damaging Het
Pira12 T A 7: 3,899,954 (GRCm39) E216V possibly damaging Het
Plcg1 G A 2: 160,589,816 (GRCm39) M113I probably benign Het
Plekhh2 T G 17: 84,879,189 (GRCm39) S638A possibly damaging Het
Ppp2r3d T A 9: 101,088,985 (GRCm39) H446L probably benign Het
Prkcg G T 7: 3,378,686 (GRCm39) D644Y probably damaging Het
Rbbp8nl G T 2: 179,921,506 (GRCm39) R293S probably benign Het
Rbl2 A T 8: 91,842,387 (GRCm39) H1057L possibly damaging Het
Rpgrip1 A T 14: 52,387,819 (GRCm39) H1076L possibly damaging Het
Scn11a A C 9: 119,611,036 (GRCm39) D938E probably benign Het
Sec24b T C 3: 129,798,650 (GRCm39) D573G probably damaging Het
Serpinf1 T G 11: 75,306,397 (GRCm39) Q147P unknown Het
Skint6 C T 4: 113,093,642 (GRCm39) G167D probably damaging Het
Slc15a5 A G 6: 138,056,898 (GRCm39) F6S probably damaging Het
Smc2 T A 4: 52,449,376 (GRCm39) I179K probably benign Het
Smpdl3a A G 10: 57,677,073 (GRCm39) K57R possibly damaging Het
Smpdl3b T A 4: 132,473,990 (GRCm39) H25L probably damaging Het
Srpk1 T C 17: 28,839,398 (GRCm39) D35G unknown Het
Strn A G 17: 78,980,076 (GRCm39) V324A probably damaging Het
Sult6b2 T C 6: 142,736,022 (GRCm39) K191E probably benign Het
Tmem168 A G 6: 13,583,324 (GRCm39) I519T probably benign Het
Tmem41a T C 16: 21,756,784 (GRCm39) T112A probably benign Het
Tmem67 A G 4: 12,058,576 (GRCm39) I507T probably benign Het
Tns1 T C 1: 74,024,201 (GRCm39) E454G probably damaging Het
Trim26 C A 17: 37,168,602 (GRCm39) D422E unknown Het
Trp53 T C 11: 69,478,409 (GRCm39) F106S probably damaging Het
Tshz3 C A 7: 36,470,962 (GRCm39) Q984K probably damaging Het
Ttll3 A G 6: 113,371,959 (GRCm39) E73G probably damaging Het
Vmn1r194 A G 13: 22,429,247 (GRCm39) N288S probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8446:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGTAGGTCTCCTTGAGCAG -3'
(R):5'- GTAGATGGACACTGTCATCAAGAAG -3'

Sequencing Primer
(F):5'- TCCTTGAGCAGGGAGATCC -3'
(R):5'- CACTGTCATCAAGAAGAGATGC -3'
Posted On 2020-09-02