Incidental Mutation 'R8344:Gsk3b'
ID645119
Institutional Source Beutler Lab
Gene Symbol Gsk3b
Ensembl Gene ENSMUSG00000022812
Gene Nameglycogen synthase kinase 3 beta
SynonymsGSK-3beta, 7330414F15Rik, GSK3, GSK-3, 8430431H08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R8344 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location38089001-38246084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38191625 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 236 (S236P)
Ref Sequence ENSEMBL: ENSMUSP00000023507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023507] [ENSMUST00000114750]
PDB Structure
Crystal structure of a transition state mimic of the GSK-3/Axin complex bound to phosphorylated N-terminal auto-inhibitory pS9 peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023507
AA Change: S236P

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023507
Gene: ENSMUSG00000022812
AA Change: S236P

DomainStartEndE-ValueType
S_TKc 56 340 1.72e-86 SMART
low complexity region 386 402 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114750
AA Change: S236P

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110398
Gene: ENSMUSG00000022812
AA Change: S236P

DomainStartEndE-ValueType
S_TKc 56 353 1.13e-86 SMART
low complexity region 399 415 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene may die embryonically around mid-gestation or neonatally. When mice die neonatally, cleft palate and sternum are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf A T 19: 31,911,119 Y83F possibly damaging Het
Adgre1 C G 17: 57,408,459 Q260E probably benign Het
Adgrf4 T A 17: 42,666,908 M515L probably benign Het
Adgrl2 A T 3: 148,859,525 C140S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Ampd1 A T 3: 103,095,686 E573V possibly damaging Het
Atxn7l3b T A 10: 112,928,662 I21F possibly damaging Het
Bckdha C T 7: 25,631,447 R298H probably damaging Het
Cacng3 A C 7: 122,768,346 I150L possibly damaging Het
Ccdc18 A T 5: 108,161,503 K321N possibly damaging Het
Ccl11 A T 11: 82,061,742 K47M possibly damaging Het
Cdkn2a T C 4: 89,276,750 I142M probably benign Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Chrna1 C A 2: 73,570,609 E192D probably benign Het
Clasp1 A G 1: 118,503,899 N420D probably damaging Het
Clca3a2 T A 3: 144,805,942 probably null Het
Cntn2 T C 1: 132,521,774 Y643C probably damaging Het
Dcun1d1 G A 3: 35,897,554 H204Y probably benign Het
Dlg2 A T 7: 92,438,014 Q767L possibly damaging Het
Dnah11 A G 12: 118,085,731 S1653P probably benign Het
Dvl3 T A 16: 20,523,763 probably null Het
Egf T C 3: 129,754,943 T8A unknown Het
Eln G T 5: 134,728,392 T219K unknown Het
Evc T C 5: 37,314,528 D536G possibly damaging Het
Fbxo3 A G 2: 104,051,208 E295G possibly damaging Het
Gm14548 T A 7: 3,896,955 E216V possibly damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Gpr37 A G 6: 25,669,531 F438S probably damaging Het
Kdm5d A G Y: 942,477 T1381A probably benign Het
Klhl12 T C 1: 134,485,722 I315T possibly damaging Het
Ltb T A 17: 35,195,193 N102K probably benign Het
Macf1 C A 4: 123,384,683 D5993Y probably damaging Het
Macf1 T C 4: 123,526,856 T202A probably benign Het
Mak T A 13: 41,046,203 D320V probably benign Het
Map2 G A 1: 66,421,713 R1556H probably damaging Het
Mgat4d G T 8: 83,368,133 M266I probably benign Het
Mmp24 G T 2: 155,810,303 R310S possibly damaging Het
Myh6 A T 14: 54,953,434 L928Q probably damaging Het
Npnt A G 3: 132,908,456 L179P probably damaging Het
Olfr1205 A G 2: 88,831,383 I89V probably benign Het
Olfr38 A G 6: 42,762,565 N171S probably benign Het
Olfr972 T G 9: 39,873,935 F220C probably benign Het
Parp4 A T 14: 56,648,729 Y1755F unknown Het
Phactr1 A G 13: 42,709,821 E74G possibly damaging Het
Plcg1 G A 2: 160,747,896 M113I probably benign Het
Plekhh2 T G 17: 84,571,761 S638A possibly damaging Het
Ppp2r3a T A 9: 101,211,786 H446L probably benign Het
Prkcg G T 7: 3,330,170 D644Y probably damaging Het
Rbbp8nl G T 2: 180,279,713 R293S probably benign Het
Rbl2 A T 8: 91,115,759 H1057L possibly damaging Het
Rpgrip1 A T 14: 52,150,362 H1076L possibly damaging Het
Scn11a A C 9: 119,781,970 D938E probably benign Het
Sec24b T C 3: 130,005,001 D573G probably damaging Het
Serpinf1 T G 11: 75,415,571 Q147P unknown Het
Skint6 C T 4: 113,236,445 G167D probably damaging Het
Slc15a5 A G 6: 138,079,900 F6S probably damaging Het
Smc2 T A 4: 52,449,376 I179K probably benign Het
Smpdl3a A G 10: 57,800,977 K57R possibly damaging Het
Smpdl3b T A 4: 132,746,679 H25L probably damaging Het
Srpk1 T C 17: 28,620,424 D35G unknown Het
Strn A G 17: 78,672,647 V324A probably damaging Het
Sult6b2 T C 6: 142,790,296 K191E probably benign Het
Tmem168 A G 6: 13,583,325 I519T probably benign Het
Tmem41a T C 16: 21,938,034 T112A probably benign Het
Tmem67 A G 4: 12,058,576 I507T probably benign Het
Tns1 T C 1: 73,985,042 E454G probably damaging Het
Trim26 C A 17: 36,857,710 D422E unknown Het
Triobp C A 15: 78,958,275 R58S possibly damaging Het
Trp53 T C 11: 69,587,583 F106S probably damaging Het
Tshz3 C A 7: 36,771,537 Q984K probably damaging Het
Ttll3 A G 6: 113,394,998 E73G probably damaging Het
Vmn1r194 A G 13: 22,245,077 N288S probably benign Het
Other mutations in Gsk3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gsk3b APN 16 38228707 missense probably benign
IGL01302:Gsk3b APN 16 38220018 missense probably benign 0.01
blue_bunny UTSW 16 38208136 intron probably benign
PIT4402001:Gsk3b UTSW 16 38089401 unclassified probably benign
PIT4585001:Gsk3b UTSW 16 38184454 missense probably damaging 1.00
R0670:Gsk3b UTSW 16 38144316 missense probably damaging 1.00
R1118:Gsk3b UTSW 16 38207984 unclassified probably benign
R1119:Gsk3b UTSW 16 38207984 unclassified probably benign
R1428:Gsk3b UTSW 16 38090575 missense probably benign 0.01
R1897:Gsk3b UTSW 16 38217084 splice site probably null
R2056:Gsk3b UTSW 16 38187909 missense probably benign
R2058:Gsk3b UTSW 16 38187909 missense probably benign
R2059:Gsk3b UTSW 16 38187909 missense probably benign
R4428:Gsk3b UTSW 16 38193936 missense probably damaging 1.00
R4594:Gsk3b UTSW 16 38170701 missense possibly damaging 0.92
R5133:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5134:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5726:Gsk3b UTSW 16 38208136 intron probably benign
R5957:Gsk3b UTSW 16 38193953 missense probably damaging 1.00
R6273:Gsk3b UTSW 16 38208046 missense probably benign 0.00
R6431:Gsk3b UTSW 16 38193949 missense probably damaging 0.99
Z1176:Gsk3b UTSW 16 38208070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGTTTCAAGTGTGTGGC -3'
(R):5'- AAAGTTCCTTCCGAGCAGCTG -3'

Sequencing Primer
(F):5'- ACAGTTTCAAGTGTGTGGCATTATTG -3'
(R):5'- GAGCACGTCTTTTTGCCG -3'
Posted On2020-09-02