Incidental Mutation 'R8345:Cfap65'
ID645131
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R8345 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74928044 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 249 (G249R)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: G249R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: G249R

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,325,630 N145Y probably damaging Het
9530053A07Rik G A 7: 28,155,360 V1804M probably damaging Het
Acsf3 T C 8: 122,781,545 V260A probably benign Het
Adgrv1 T C 13: 81,103,386 D6204G probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Aspm T G 1: 139,464,273 Y787* probably null Het
Atp8b5 A C 4: 43,291,714 D29A probably benign Het
Bdh2 A T 3: 135,295,252 I128F probably damaging Het
Bmper T A 9: 23,224,830 M69K probably benign Het
Ccdc7a C T 8: 128,798,764 M1415I probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cdc23 G A 18: 34,634,097 T564I probably benign Het
Cemip T A 7: 83,942,165 probably null Het
Cpsf1 T A 15: 76,601,490 T435S probably benign Het
Dennd5a T C 7: 109,905,270 T879A possibly damaging Het
Diaph3 G A 14: 86,829,093 Q955* probably null Het
Disp2 G A 2: 118,810,803 V298M unknown Het
Dnah1 C A 14: 31,264,594 D3671Y probably damaging Het
Dnmt3a T C 12: 3,835,234 S13P unknown Het
Eci3 G A 13: 34,948,181 T228I probably damaging Het
Ecm2 T C 13: 49,520,800 L232P probably benign Het
Ednra G A 8: 77,689,184 R145C probably damaging Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Fam8a1 T A 13: 46,673,578 I275K probably damaging Het
Fat3 C A 9: 15,999,274 V1811L probably benign Het
Fbn2 C T 18: 58,058,431 C1540Y probably damaging Het
Ffar3 A G 7: 30,855,364 L177P probably damaging Het
Fmnl1 A G 11: 103,186,614 T267A possibly damaging Het
Fsip1 T C 2: 118,240,471 E246G probably damaging Het
Gemin4 A G 11: 76,210,779 L1052P probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Grm5 A T 7: 88,074,538 I679F probably damaging Het
Hapln1 A T 13: 89,584,783 D21V probably benign Het
Jak2 T C 19: 29,284,870 S364P probably damaging Het
Kansl3 A G 1: 36,348,816 probably null Het
Kntc1 T C 5: 123,786,930 L1102S probably benign Het
Mbd3l2 A G 9: 18,444,483 I35V probably benign Het
Mdfic G T 6: 15,799,654 C260F probably damaging Het
Mroh2b T C 15: 4,944,326 S1109P probably benign Het
Myocd A T 11: 65,187,132 C612* probably null Het
Olfr1053 A T 2: 86,315,107 Y60N probably damaging Het
Olfr1189 A G 2: 88,592,091 M96V probably benign Het
Olfr1293-ps T A 2: 111,527,519 C86* probably null Het
Olfr142 A T 2: 90,252,217 M257K possibly damaging Het
Olfr153 A T 2: 87,532,347 T105S probably benign Het
Olfr652 T A 7: 104,564,224 M1K probably null Het
Pard3 C T 8: 127,324,068 R204W probably damaging Het
Per1 T A 11: 69,107,556 N1031K possibly damaging Het
Plekhh3 A G 11: 101,164,279 S583P unknown Het
Pramef8 C T 4: 143,416,868 T68I probably benign Het
Prex2 T A 1: 11,199,894 C1268S possibly damaging Het
Prpf6 T C 2: 181,650,158 I756T probably benign Het
Pum2 T C 12: 8,709,454 V98A probably damaging Het
Rad50 A T 11: 53,684,141 S652T probably benign Het
Rfng G T 11: 120,784,075 P30T unknown Het
Rfx7 T C 9: 72,617,691 I721T probably benign Het
Rpf1 G T 3: 146,507,676 T240K probably benign Het
Ryr3 T C 2: 112,652,925 N4189S probably benign Het
Samd15 G C 12: 87,201,438 R299T probably benign Het
Scn3a A G 2: 65,498,991 M765T possibly damaging Het
Scn9a G A 2: 66,494,622 S1396L probably damaging Het
Sec24a C T 11: 51,743,778 R107Q probably benign Het
Sema4b T A 7: 80,220,819 V505E probably damaging Het
Siglec1 T A 2: 131,078,578 T769S possibly damaging Het
Sit1 T C 4: 43,483,168 E69G possibly damaging Het
Slc12a8 C A 16: 33,550,951 D121E probably benign Het
Slc30a10 A T 1: 185,455,467 Q135L probably benign Het
Suox A G 10: 128,671,331 V276A probably benign Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tmed5 A G 5: 108,125,957 W139R probably damaging Het
Tnks1bp1 C T 2: 85,062,882 T389I possibly damaging Het
Vmn1r65 A T 7: 6,008,257 I326K probably benign Het
Vmn2r43 A G 7: 8,253,602 S421P possibly damaging Het
Vmn2r57 A T 7: 41,427,544 N399K possibly damaging Het
Vmn2r90 T A 17: 17,712,865 L229* probably null Het
Vwf A T 6: 125,679,302 D2610V Het
Zfp646 C T 7: 127,883,910 S1753L probably benign Het
Zfy2 C A Y: 2,107,096 V513F possibly damaging Het
Zranb2 A T 3: 157,546,094 I317F unknown Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCGTGTATCGTGTGTCC -3'
(R):5'- ACTCCCTCACTCTTAGGGAC -3'

Sequencing Primer
(F):5'- TCTACCACTGGGAGGGATAGTC -3'
(R):5'- TCACTCTTAGGGACCTGCC -3'
Posted On2020-09-02