Incidental Mutation 'R8345:Olfr142'
ID645140
Institutional Source Beutler Lab
Gene Symbol Olfr142
Ensembl Gene ENSMUSG00000075063
Gene Nameolfactory receptor 142
SynonymsGA_x6K02T2Q125-51607674-51606757, K20, MOR227-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8345 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90250130-90257592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90252217 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 257 (M257K)
Ref Sequence ENSEMBL: ENSMUSP00000150216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099752
AA Change: M257K

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: M257K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 300 3e-6 PFAM
Pfam:7tm_1 39 285 5.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213968
AA Change: M257K

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,325,630 N145Y probably damaging Het
9530053A07Rik G A 7: 28,155,360 V1804M probably damaging Het
Acsf3 T C 8: 122,781,545 V260A probably benign Het
Adgrv1 T C 13: 81,103,386 D6204G probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Aspm T G 1: 139,464,273 Y787* probably null Het
Atp8b5 A C 4: 43,291,714 D29A probably benign Het
Bdh2 A T 3: 135,295,252 I128F probably damaging Het
Bmper T A 9: 23,224,830 M69K probably benign Het
Ccdc7a C T 8: 128,798,764 M1415I probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cdc23 G A 18: 34,634,097 T564I probably benign Het
Cemip T A 7: 83,942,165 probably null Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpsf1 T A 15: 76,601,490 T435S probably benign Het
Dennd5a T C 7: 109,905,270 T879A possibly damaging Het
Diaph3 G A 14: 86,829,093 Q955* probably null Het
Disp2 G A 2: 118,810,803 V298M unknown Het
Dnah1 C A 14: 31,264,594 D3671Y probably damaging Het
Dnmt3a T C 12: 3,835,234 S13P unknown Het
Eci3 G A 13: 34,948,181 T228I probably damaging Het
Ecm2 T C 13: 49,520,800 L232P probably benign Het
Ednra G A 8: 77,689,184 R145C probably damaging Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Fam8a1 T A 13: 46,673,578 I275K probably damaging Het
Fat3 C A 9: 15,999,274 V1811L probably benign Het
Fbn2 C T 18: 58,058,431 C1540Y probably damaging Het
Ffar3 A G 7: 30,855,364 L177P probably damaging Het
Fmnl1 A G 11: 103,186,614 T267A possibly damaging Het
Fsip1 T C 2: 118,240,471 E246G probably damaging Het
Gemin4 A G 11: 76,210,779 L1052P probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Grm5 A T 7: 88,074,538 I679F probably damaging Het
Hapln1 A T 13: 89,584,783 D21V probably benign Het
Jak2 T C 19: 29,284,870 S364P probably damaging Het
Kansl3 A G 1: 36,348,816 probably null Het
Kntc1 T C 5: 123,786,930 L1102S probably benign Het
Mbd3l2 A G 9: 18,444,483 I35V probably benign Het
Mdfic G T 6: 15,799,654 C260F probably damaging Het
Mroh2b T C 15: 4,944,326 S1109P probably benign Het
Myocd A T 11: 65,187,132 C612* probably null Het
Olfr1053 A T 2: 86,315,107 Y60N probably damaging Het
Olfr1189 A G 2: 88,592,091 M96V probably benign Het
Olfr1293-ps T A 2: 111,527,519 C86* probably null Het
Olfr153 A T 2: 87,532,347 T105S probably benign Het
Olfr652 T A 7: 104,564,224 M1K probably null Het
Pard3 C T 8: 127,324,068 R204W probably damaging Het
Per1 T A 11: 69,107,556 N1031K possibly damaging Het
Plekhh3 A G 11: 101,164,279 S583P unknown Het
Pramef8 C T 4: 143,416,868 T68I probably benign Het
Prex2 T A 1: 11,199,894 C1268S possibly damaging Het
Prpf6 T C 2: 181,650,158 I756T probably benign Het
Pum2 T C 12: 8,709,454 V98A probably damaging Het
Rad50 A T 11: 53,684,141 S652T probably benign Het
Rfng G T 11: 120,784,075 P30T unknown Het
Rfx7 T C 9: 72,617,691 I721T probably benign Het
Rpf1 G T 3: 146,507,676 T240K probably benign Het
Ryr3 T C 2: 112,652,925 N4189S probably benign Het
Samd15 G C 12: 87,201,438 R299T probably benign Het
Scn3a A G 2: 65,498,991 M765T possibly damaging Het
Scn9a G A 2: 66,494,622 S1396L probably damaging Het
Sec24a C T 11: 51,743,778 R107Q probably benign Het
Sema4b T A 7: 80,220,819 V505E probably damaging Het
Siglec1 T A 2: 131,078,578 T769S possibly damaging Het
Sit1 T C 4: 43,483,168 E69G possibly damaging Het
Slc12a8 C A 16: 33,550,951 D121E probably benign Het
Slc30a10 A T 1: 185,455,467 Q135L probably benign Het
Suox A G 10: 128,671,331 V276A probably benign Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tmed5 A G 5: 108,125,957 W139R probably damaging Het
Tnks1bp1 C T 2: 85,062,882 T389I possibly damaging Het
Vmn1r65 A T 7: 6,008,257 I326K probably benign Het
Vmn2r43 A G 7: 8,253,602 S421P possibly damaging Het
Vmn2r57 A T 7: 41,427,544 N399K possibly damaging Het
Vmn2r90 T A 17: 17,712,865 L229* probably null Het
Vwf A T 6: 125,679,302 D2610V Het
Zfp646 C T 7: 127,883,910 S1753L probably benign Het
Zfy2 C A Y: 2,107,096 V513F possibly damaging Het
Zranb2 A T 3: 157,546,094 I317F unknown Het
Other mutations in Olfr142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01623:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01810:Olfr142 APN 2 90252132 nonsense probably null
IGL01918:Olfr142 APN 2 90252331 missense probably damaging 1.00
IGL02619:Olfr142 APN 2 90252505 missense probably damaging 0.97
IGL02732:Olfr142 APN 2 90252308 missense probably damaging 1.00
IGL02738:Olfr142 APN 2 90252355 missense possibly damaging 0.82
IGL02795:Olfr142 APN 2 90252562 missense probably damaging 1.00
IGL02830:Olfr142 APN 2 90252781 missense probably damaging 1.00
R0601:Olfr142 UTSW 2 90252934 missense probably benign 0.05
R2004:Olfr142 UTSW 2 90252692 missense probably benign 0.04
R2136:Olfr142 UTSW 2 90252253 missense probably damaging 0.98
R2377:Olfr142 UTSW 2 90252911 missense probably damaging 1.00
R3615:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3616:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3777:Olfr142 UTSW 2 90252625 missense probably damaging 1.00
R4763:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R4765:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R5421:Olfr142 UTSW 2 90252745 missense probably benign 0.01
R5426:Olfr142 UTSW 2 90252611 nonsense probably null
R6063:Olfr142 UTSW 2 90252427 missense probably benign 0.40
R6717:Olfr142 UTSW 2 90252524 missense probably benign 0.00
R6931:Olfr142 UTSW 2 90252777 nonsense probably null
R6936:Olfr142 UTSW 2 90252334 missense probably benign 0.17
R7013:Olfr142 UTSW 2 90252097 missense possibly damaging 0.87
R7091:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R7247:Olfr142 UTSW 2 90252821 missense probably damaging 1.00
R8169:Olfr142 UTSW 2 90252098 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTACTAAAGACAGATCCCATTTC -3'
(R):5'- CACTGACACCTTTATGGAGGG -3'

Sequencing Primer
(F):5'- TAAAGACAGATCCCATTTCAATAAGC -3'
(R):5'- GGTTTATTGTGATGGCCAACAG -3'
Posted On2020-09-02