Mutagenetix > Incidental Mutation

Incidental Mutation 'R0030:Scp2'

64515

Institutional Source

Beutler Lab

Gene Symbol

Scp2

Ensembl Gene

ENSMUSG00000028603

Gene Name

sterol carrier protein 2, liver

Synonyms

ns-LTP, SCPx, nonspecific lipid transfer protein, NSL-TP, SCP-2

MMRRC Submission

038324-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R0030 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

107901027-108002168 bp(-) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 107964887 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121673 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030340] [ENSMUST00000030340] [ENSMUST00000130776] [ENSMUST00000130776] [ENSMUST00000130776] [ENSMUST00000130776] [ENSMUST00000149106] [ENSMUST00000149106] [ENSMUST00000149106] [ENSMUST00000149106]

AlphaFold

P32020

Predicted Effect

probably null
Transcript: ENSMUST00000030340

SMART Domains

Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
Pfam:Thiolase_N	14	240	9.6e-25	PFAM
Pfam:Thiolase_C	277	402	2.9e-15	PFAM
Pfam:SCP2	437	539	1.5e-32	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000030340

SMART Domains

Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
Pfam:Thiolase_N	14	240	9.6e-25	PFAM
Pfam:Thiolase_C	277	402	2.9e-15	PFAM
Pfam:SCP2	437	539	1.5e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123792

Predicted Effect

probably null
Transcript: ENSMUST00000130776

SMART Domains

Protein: ENSMUSP00000123630
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
Pfam:Thiolase_N	9	110	2.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130776

SMART Domains

Protein: ENSMUSP00000123630
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
Pfam:Thiolase_N	9	110	2.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130776

SMART Domains

Protein: ENSMUSP00000123630
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
Pfam:Thiolase_N	9	110	2.9e-12	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000130776

SMART Domains

Protein: ENSMUSP00000123630
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
Pfam:Thiolase_N	9	110	2.9e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143340

Predicted Effect

probably null
Transcript: ENSMUST00000149106

SMART Domains

Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
SCOP:d1qfla1	14	202	2e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000149106

SMART Domains

Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
SCOP:d1qfla1	14	202	2e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000149106

SMART Domains

Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
SCOP:d1qfla1	14	202	2e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000149106

SMART Domains

Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603

Domain	Start	End	E-Value	Type
SCOP:d1qfla1	14	202	2e-18	SMART

Meta Mutation Damage Score

0.9486

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene exhibit altered lipid levels and both males and females are sensitive to phytol-rich diets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap1	T	A	1: 89,816,466 (GRCm39)	Y755*	probably null	Het
Ahctf1	G	A	1: 179,580,001 (GRCm39)	T2067M	probably damaging	Het
Ank1	C	A	8: 23,583,909 (GRCm39)	D337E	probably damaging	Het
Ankrd65	A	C	4: 155,875,942 (GRCm39)	R72S	probably damaging	Het
Cacna1s	T	C	1: 136,022,727 (GRCm39)		probably null	Het
Cyp4f40	T	C	17: 32,894,947 (GRCm39)	S462P	probably damaging	Het
Dxo	A	G	17: 35,056,914 (GRCm39)	R132G	probably damaging	Het
Eps15l1	A	G	8: 73,126,894 (GRCm39)	S646P	probably benign	Het
Foxi2	A	G	7: 135,013,345 (GRCm39)	T192A	probably damaging	Het
Fry	T	A	5: 150,296,034 (GRCm39)	C480*	probably null	Het
Gak	C	T	5: 108,761,413 (GRCm39)	W206*	probably null	Het
Ggt7	G	T	2: 155,348,408 (GRCm39)	D5E	probably benign	Het
Hectd4	G	T	5: 121,400,651 (GRCm39)	G339*	probably null	Het
Ikzf3	T	C	11: 98,358,438 (GRCm39)	T300A	probably benign	Het
Med12l	T	G	3: 59,156,076 (GRCm39)	L1198R	probably damaging	Het
Odf4	T	A	11: 68,817,767 (GRCm39)	E9D	probably benign	Het
Or2t26	T	A	11: 49,039,867 (GRCm39)	M261K	possibly damaging	Het
Pax1	C	A	2: 147,210,502 (GRCm39)	F412L	probably damaging	Het
Polg	A	T	7: 79,101,876 (GRCm39)	I1006N	probably damaging	Het
Ppp4c	A	G	7: 126,387,605 (GRCm39)	V51A	possibly damaging	Het
Scn10a	G	C	9: 119,499,056 (GRCm39)	T304R	probably benign	Het
Ubr4	G	T	4: 139,154,104 (GRCm39)	V2104L	probably damaging	Het

Other mutations in Scp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01481:Scp2	APN	4	107,931,639 (GRCm39)	splice site	probably null
IGL02190:Scp2	APN	4	107,944,325 (GRCm39)	missense	probably benign	0.22
IGL02615:Scp2	APN	4	107,964,828 (GRCm39)	missense	probably benign	0.40
IGL03006:Scp2	APN	4	107,948,477 (GRCm39)	missense	probably benign	0.00
IGL03107:Scp2	APN	4	107,955,312 (GRCm39)	missense	probably benign	0.00
IGL03124:Scp2	APN	4	107,921,103 (GRCm39)	missense	probably damaging	1.00
R0030:Scp2	UTSW	4	107,964,887 (GRCm39)	critical splice acceptor site	probably null
R0240:Scp2	UTSW	4	107,955,275 (GRCm39)	missense	probably benign	0.01
R0240:Scp2	UTSW	4	107,955,275 (GRCm39)	missense	probably benign	0.01
R1507:Scp2	UTSW	4	107,944,209 (GRCm39)	frame shift	probably null
R1861:Scp2	UTSW	4	107,948,518 (GRCm39)	missense	probably damaging	1.00
R2151:Scp2	UTSW	4	107,921,141 (GRCm39)	missense	probably benign
R3013:Scp2	UTSW	4	107,928,554 (GRCm39)	missense	probably damaging	1.00
R4127:Scp2	UTSW	4	107,921,181 (GRCm39)	missense	probably benign	0.00
R4271:Scp2	UTSW	4	107,942,408 (GRCm39)	missense	probably damaging	1.00
R4385:Scp2	UTSW	4	107,928,547 (GRCm39)	missense	probably damaging	1.00
R5046:Scp2	UTSW	4	107,928,488 (GRCm39)	missense	probably benign	0.07
R5345:Scp2	UTSW	4	107,912,776 (GRCm39)	splice site	probably null
R5401:Scp2	UTSW	4	108,001,976 (GRCm39)	critical splice donor site	probably null
R6367:Scp2	UTSW	4	107,969,447 (GRCm39)	missense	probably damaging	1.00
R6415:Scp2	UTSW	4	107,962,337 (GRCm39)	missense	probably benign	0.22
R6681:Scp2	UTSW	4	107,948,513 (GRCm39)	missense	probably damaging	1.00
R6910:Scp2	UTSW	4	107,962,283 (GRCm39)	missense	probably damaging	1.00
R6974:Scp2	UTSW	4	107,928,475 (GRCm39)	start codon destroyed	probably null	0.01
R7206:Scp2	UTSW	4	107,931,638 (GRCm39)	missense	probably benign	0.00
R7342:Scp2	UTSW	4	107,948,518 (GRCm39)	missense	probably benign	0.02
R8935:Scp2	UTSW	4	107,950,072 (GRCm39)	missense	probably damaging	0.98
R9035:Scp2	UTSW	4	107,912,717 (GRCm39)	missense	probably damaging	1.00
R9151:Scp2	UTSW	4	107,931,603 (GRCm39)	missense	possibly damaging	0.58
R9536:Scp2	UTSW	4	107,928,532 (GRCm39)	missense	possibly damaging	0.92
R9645:Scp2	UTSW	4	107,948,519 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CACAATGGCAAGAACAATTACAGTGAGC -3'
(R):5'- CCATCTCCACCTTTGATGTGAAGGAAG -3'

Sequencing Primer
(F):5'- GTGAGCCAACACACAAAGG -3'
(R):5'- CCACCTTTGATGTGAAGGAAGATATG -3'

Posted On

2013-08-06