Incidental Mutation 'R8345:Atp8b5'
ID645150
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8345 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43291714 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 29 (D29A)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102953] [ENSMUST00000107937] [ENSMUST00000107942] [ENSMUST00000136262]
Predicted Effect probably benign
Transcript: ENSMUST00000102953
AA Change: D29A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000100018
Gene: ENSMUSG00000028457
AA Change: D29A

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
Blast:CUB 55 90 1e-6 BLAST
Pfam:E1-E2_ATPase 107 305 4.7e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107937
AA Change: D29A

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000107942
AA Change: D29A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: D29A

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136262
AA Change: D29A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,325,630 N145Y probably damaging Het
9530053A07Rik G A 7: 28,155,360 V1804M probably damaging Het
Acsf3 T C 8: 122,781,545 V260A probably benign Het
Adgrv1 T C 13: 81,103,386 D6204G probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Aspm T G 1: 139,464,273 Y787* probably null Het
Bdh2 A T 3: 135,295,252 I128F probably damaging Het
Bmper T A 9: 23,224,830 M69K probably benign Het
Ccdc7a C T 8: 128,798,764 M1415I probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cdc23 G A 18: 34,634,097 T564I probably benign Het
Cemip T A 7: 83,942,165 probably null Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpsf1 T A 15: 76,601,490 T435S probably benign Het
Dennd5a T C 7: 109,905,270 T879A possibly damaging Het
Diaph3 G A 14: 86,829,093 Q955* probably null Het
Disp2 G A 2: 118,810,803 V298M unknown Het
Dnah1 C A 14: 31,264,594 D3671Y probably damaging Het
Dnmt3a T C 12: 3,835,234 S13P unknown Het
Eci3 G A 13: 34,948,181 T228I probably damaging Het
Ecm2 T C 13: 49,520,800 L232P probably benign Het
Ednra G A 8: 77,689,184 R145C probably damaging Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Fam8a1 T A 13: 46,673,578 I275K probably damaging Het
Fat3 C A 9: 15,999,274 V1811L probably benign Het
Fbn2 C T 18: 58,058,431 C1540Y probably damaging Het
Ffar3 A G 7: 30,855,364 L177P probably damaging Het
Fmnl1 A G 11: 103,186,614 T267A possibly damaging Het
Fsip1 T C 2: 118,240,471 E246G probably damaging Het
Gemin4 A G 11: 76,210,779 L1052P probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Grm5 A T 7: 88,074,538 I679F probably damaging Het
Hapln1 A T 13: 89,584,783 D21V probably benign Het
Jak2 T C 19: 29,284,870 S364P probably damaging Het
Kansl3 A G 1: 36,348,816 probably null Het
Kntc1 T C 5: 123,786,930 L1102S probably benign Het
Mbd3l2 A G 9: 18,444,483 I35V probably benign Het
Mdfic G T 6: 15,799,654 C260F probably damaging Het
Mroh2b T C 15: 4,944,326 S1109P probably benign Het
Myocd A T 11: 65,187,132 C612* probably null Het
Olfr1053 A T 2: 86,315,107 Y60N probably damaging Het
Olfr1189 A G 2: 88,592,091 M96V probably benign Het
Olfr1293-ps T A 2: 111,527,519 C86* probably null Het
Olfr142 A T 2: 90,252,217 M257K possibly damaging Het
Olfr153 A T 2: 87,532,347 T105S probably benign Het
Olfr652 T A 7: 104,564,224 M1K probably null Het
Pard3 C T 8: 127,324,068 R204W probably damaging Het
Per1 T A 11: 69,107,556 N1031K possibly damaging Het
Plekhh3 A G 11: 101,164,279 S583P unknown Het
Pramef8 C T 4: 143,416,868 T68I probably benign Het
Prex2 T A 1: 11,199,894 C1268S possibly damaging Het
Prpf6 T C 2: 181,650,158 I756T probably benign Het
Pum2 T C 12: 8,709,454 V98A probably damaging Het
Rad50 A T 11: 53,684,141 S652T probably benign Het
Rfng G T 11: 120,784,075 P30T unknown Het
Rfx7 T C 9: 72,617,691 I721T probably benign Het
Rpf1 G T 3: 146,507,676 T240K probably benign Het
Ryr3 T C 2: 112,652,925 N4189S probably benign Het
Samd15 G C 12: 87,201,438 R299T probably benign Het
Scn3a A G 2: 65,498,991 M765T possibly damaging Het
Scn9a G A 2: 66,494,622 S1396L probably damaging Het
Sec24a C T 11: 51,743,778 R107Q probably benign Het
Sema4b T A 7: 80,220,819 V505E probably damaging Het
Siglec1 T A 2: 131,078,578 T769S possibly damaging Het
Sit1 T C 4: 43,483,168 E69G possibly damaging Het
Slc12a8 C A 16: 33,550,951 D121E probably benign Het
Slc30a10 A T 1: 185,455,467 Q135L probably benign Het
Suox A G 10: 128,671,331 V276A probably benign Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tmed5 A G 5: 108,125,957 W139R probably damaging Het
Tnks1bp1 C T 2: 85,062,882 T389I possibly damaging Het
Vmn1r65 A T 7: 6,008,257 I326K probably benign Het
Vmn2r43 A G 7: 8,253,602 S421P possibly damaging Het
Vmn2r57 A T 7: 41,427,544 N399K possibly damaging Het
Vmn2r90 T A 17: 17,712,865 L229* probably null Het
Vwf A T 6: 125,679,302 D2610V Het
Zfp646 C T 7: 127,883,910 S1753L probably benign Het
Zfy2 C A Y: 2,107,096 V513F possibly damaging Het
Zranb2 A T 3: 157,546,094 I317F unknown Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43355673 missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43357016 missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43371003 missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43370823 critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43366735 missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43342471 missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43356982 nonsense probably null
R8218:Atp8b5 UTSW 4 43372728 critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43366072 missense probably damaging 0.97
R8756:Atp8b5 UTSW 4 43342439 missense probably damaging 0.98
R8888:Atp8b5 UTSW 4 43304687 missense
R8942:Atp8b5 UTSW 4 43353658 missense probably damaging 1.00
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43361903 missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43370669 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGCTAGTCATATGTGTGAGAGTTCG -3'
(R):5'- TGTCATATACATGCATGTGCTTGC -3'

Sequencing Primer
(F):5'- CGATTATTTTGGGTTTCAGAGATGG -3'
(R):5'- TGTGCTTGCACACAGGAG -3'
Posted On2020-09-02