Incidental Mutation 'R8345:Vwf'
ID645157
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene NameVon Willebrand factor
Synonyms6820430P06Rik, B130011O06Rik
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R8345 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125546774-125686679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125679302 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 2610 (D2610V)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
Predicted Effect
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: D2610V

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147101
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,325,630 N145Y probably damaging Het
9530053A07Rik G A 7: 28,155,360 V1804M probably damaging Het
Acsf3 T C 8: 122,781,545 V260A probably benign Het
Adgrv1 T C 13: 81,103,386 D6204G probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Aspm T G 1: 139,464,273 Y787* probably null Het
Atp8b5 A C 4: 43,291,714 D29A probably benign Het
Bdh2 A T 3: 135,295,252 I128F probably damaging Het
Bmper T A 9: 23,224,830 M69K probably benign Het
Ccdc7a C T 8: 128,798,764 M1415I probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cdc23 G A 18: 34,634,097 T564I probably benign Het
Cemip T A 7: 83,942,165 probably null Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpsf1 T A 15: 76,601,490 T435S probably benign Het
Dennd5a T C 7: 109,905,270 T879A possibly damaging Het
Diaph3 G A 14: 86,829,093 Q955* probably null Het
Disp2 G A 2: 118,810,803 V298M unknown Het
Dnah1 C A 14: 31,264,594 D3671Y probably damaging Het
Dnmt3a T C 12: 3,835,234 S13P unknown Het
Eci3 G A 13: 34,948,181 T228I probably damaging Het
Ecm2 T C 13: 49,520,800 L232P probably benign Het
Ednra G A 8: 77,689,184 R145C probably damaging Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Fam8a1 T A 13: 46,673,578 I275K probably damaging Het
Fat3 C A 9: 15,999,274 V1811L probably benign Het
Fbn2 C T 18: 58,058,431 C1540Y probably damaging Het
Ffar3 A G 7: 30,855,364 L177P probably damaging Het
Fmnl1 A G 11: 103,186,614 T267A possibly damaging Het
Fsip1 T C 2: 118,240,471 E246G probably damaging Het
Gemin4 A G 11: 76,210,779 L1052P probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Grm5 A T 7: 88,074,538 I679F probably damaging Het
Hapln1 A T 13: 89,584,783 D21V probably benign Het
Jak2 T C 19: 29,284,870 S364P probably damaging Het
Kansl3 A G 1: 36,348,816 probably null Het
Kntc1 T C 5: 123,786,930 L1102S probably benign Het
Mbd3l2 A G 9: 18,444,483 I35V probably benign Het
Mdfic G T 6: 15,799,654 C260F probably damaging Het
Mroh2b T C 15: 4,944,326 S1109P probably benign Het
Myocd A T 11: 65,187,132 C612* probably null Het
Olfr1053 A T 2: 86,315,107 Y60N probably damaging Het
Olfr1189 A G 2: 88,592,091 M96V probably benign Het
Olfr1293-ps T A 2: 111,527,519 C86* probably null Het
Olfr142 A T 2: 90,252,217 M257K possibly damaging Het
Olfr153 A T 2: 87,532,347 T105S probably benign Het
Olfr652 T A 7: 104,564,224 M1K probably null Het
Pard3 C T 8: 127,324,068 R204W probably damaging Het
Per1 T A 11: 69,107,556 N1031K possibly damaging Het
Plekhh3 A G 11: 101,164,279 S583P unknown Het
Pramef8 C T 4: 143,416,868 T68I probably benign Het
Prex2 T A 1: 11,199,894 C1268S possibly damaging Het
Prpf6 T C 2: 181,650,158 I756T probably benign Het
Pum2 T C 12: 8,709,454 V98A probably damaging Het
Rad50 A T 11: 53,684,141 S652T probably benign Het
Rfng G T 11: 120,784,075 P30T unknown Het
Rfx7 T C 9: 72,617,691 I721T probably benign Het
Rpf1 G T 3: 146,507,676 T240K probably benign Het
Ryr3 T C 2: 112,652,925 N4189S probably benign Het
Samd15 G C 12: 87,201,438 R299T probably benign Het
Scn3a A G 2: 65,498,991 M765T possibly damaging Het
Scn9a G A 2: 66,494,622 S1396L probably damaging Het
Sec24a C T 11: 51,743,778 R107Q probably benign Het
Sema4b T A 7: 80,220,819 V505E probably damaging Het
Siglec1 T A 2: 131,078,578 T769S possibly damaging Het
Sit1 T C 4: 43,483,168 E69G possibly damaging Het
Slc12a8 C A 16: 33,550,951 D121E probably benign Het
Slc30a10 A T 1: 185,455,467 Q135L probably benign Het
Suox A G 10: 128,671,331 V276A probably benign Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tmed5 A G 5: 108,125,957 W139R probably damaging Het
Tnks1bp1 C T 2: 85,062,882 T389I possibly damaging Het
Vmn1r65 A T 7: 6,008,257 I326K probably benign Het
Vmn2r43 A G 7: 8,253,602 S421P possibly damaging Het
Vmn2r57 A T 7: 41,427,544 N399K possibly damaging Het
Vmn2r90 T A 17: 17,712,865 L229* probably null Het
Zfp646 C T 7: 127,883,910 S1753L probably benign Het
Zfy2 C A Y: 2,107,096 V513F possibly damaging Het
Zranb2 A T 3: 157,546,094 I317F unknown Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- AACACATTTCCGTTGCACAC -3'
(R):5'- GGTGTCCTGTCAGGTATTTCCC -3'

Sequencing Primer
(F):5'- CAGTCTCCACATTTAAGGTAGGG -3'
(R):5'- CCTGTCAGGTATTTCCCATAATCAG -3'
Posted On2020-09-02