Incidental Mutation 'R0030:Ankrd65'
ID64517
Institutional Source Beutler Lab
Gene Symbol Ankrd65
Ensembl Gene ENSMUSG00000078487
Gene Nameankyrin repeat domain 65
SynonymsE230028L10Rik
MMRRC Submission 038324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0030 (G1)
Quality Score95
Status Not validated
Chromosome4
Chromosomal Location155790439-155799503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 155791485 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 72 (R72S)
Ref Sequence ENSEMBL: ENSMUSP00000129173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105593] [ENSMUST00000165000]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105593
AA Change: R54S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101218
Gene: ENSMUSG00000078487
AA Change: R54S

DomainStartEndE-ValueType
ANK 32 61 2.32e2 SMART
ANK 65 94 1.31e-4 SMART
ANK 98 127 2.16e-5 SMART
ANK 165 195 2.47e0 SMART
low complexity region 205 215 N/A INTRINSIC
low complexity region 225 237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165000
AA Change: R72S

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129173
Gene: ENSMUSG00000078487
AA Change: R72S

DomainStartEndE-ValueType
ANK 50 79 2.32e2 SMART
ANK 83 112 1.31e-4 SMART
ANK 116 145 2.16e-5 SMART
Blast:ANK 149 178 4e-6 BLAST
ANK 183 213 2.47e0 SMART
low complexity region 223 233 N/A INTRINSIC
ANK 243 272 2.15e0 SMART
ANK 276 305 8.99e-3 SMART
ANK 309 338 6.76e-7 SMART
ANK 342 371 9.93e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185136
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T A 1: 89,888,744 Y755* probably null Het
Ahctf1 G A 1: 179,752,436 T2067M probably damaging Het
Ank1 C A 8: 23,093,893 D337E probably damaging Het
Cacna1s T C 1: 136,094,989 probably null Het
Cyp4f40 T C 17: 32,675,973 S462P probably damaging Het
Dxo A G 17: 34,837,938 R132G probably damaging Het
Eps15l1 A G 8: 72,373,050 S646P probably benign Het
Foxi2 A G 7: 135,411,616 T192A probably damaging Het
Fry T A 5: 150,372,569 C480* probably null Het
Gak C T 5: 108,613,547 W206* probably null Het
Ggt7 G T 2: 155,506,488 D5E probably benign Het
Hectd4 G T 5: 121,262,588 G339* probably null Het
Ikzf3 T C 11: 98,467,612 T300A probably benign Het
Med12l T G 3: 59,248,655 L1198R probably damaging Het
Odf4 T A 11: 68,926,941 E9D probably benign Het
Olfr1395 T A 11: 49,149,040 M261K possibly damaging Het
Pax1 C A 2: 147,368,582 F412L probably damaging Het
Polg A T 7: 79,452,128 I1006N probably damaging Het
Ppp4c A G 7: 126,788,433 V51A possibly damaging Het
Scn10a G C 9: 119,669,990 T304R probably benign Het
Scp2 T A 4: 108,107,690 probably null Het
Ubr4 G T 4: 139,426,793 V2104L probably damaging Het
Other mutations in Ankrd65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Ankrd65 APN 4 155791391 missense possibly damaging 0.85
R0492:Ankrd65 UTSW 4 155790676 splice site probably benign
R1468:Ankrd65 UTSW 4 155792905 missense probably benign 0.35
R1468:Ankrd65 UTSW 4 155792905 missense probably benign 0.35
R1660:Ankrd65 UTSW 4 155792071 missense probably damaging 0.98
R2120:Ankrd65 UTSW 4 155792073 missense probably benign
R2516:Ankrd65 UTSW 4 155791411 missense possibly damaging 0.53
R4781:Ankrd65 UTSW 4 155793036 missense possibly damaging 0.90
R6790:Ankrd65 UTSW 4 155792803 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGACATGGTGACAAGGGACACCTG -3'
(R):5'- ACGTCGCAGCAATAGTTCTGCC -3'

Sequencing Primer
(F):5'- CCTGGTAAGGTGAACCAGC -3'
(R):5'- AGCAATAGTTCTGCCACGTTTG -3'
Posted On2013-08-06