Incidental Mutation 'R8345:Fmnl1'
ID645188
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Nameformin-like 1
Synonymsformin-related gene in leukocytes, 8030453N10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R8345 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103171107-103198901 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103186614 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Ref Sequence ENSEMBL: ENSMUSP00000046296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000218163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042286
AA Change: T267A

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: T267A

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107027
AA Change: T267A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: T267A

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218163
AA Change: T273A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,325,630 N145Y probably damaging Het
9530053A07Rik G A 7: 28,155,360 V1804M probably damaging Het
Acsf3 T C 8: 122,781,545 V260A probably benign Het
Adgrv1 T C 13: 81,103,386 D6204G probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Aspm T G 1: 139,464,273 Y787* probably null Het
Atp8b5 A C 4: 43,291,714 D29A probably benign Het
Bdh2 A T 3: 135,295,252 I128F probably damaging Het
Bmper T A 9: 23,224,830 M69K probably benign Het
Ccdc7a C T 8: 128,798,764 M1415I probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cdc23 G A 18: 34,634,097 T564I probably benign Het
Cemip T A 7: 83,942,165 probably null Het
Cfap65 C T 1: 74,928,044 G249R probably benign Het
Cpsf1 T A 15: 76,601,490 T435S probably benign Het
Dennd5a T C 7: 109,905,270 T879A possibly damaging Het
Diaph3 G A 14: 86,829,093 Q955* probably null Het
Disp2 G A 2: 118,810,803 V298M unknown Het
Dnah1 C A 14: 31,264,594 D3671Y probably damaging Het
Dnmt3a T C 12: 3,835,234 S13P unknown Het
Eci3 G A 13: 34,948,181 T228I probably damaging Het
Ecm2 T C 13: 49,520,800 L232P probably benign Het
Ednra G A 8: 77,689,184 R145C probably damaging Het
Faap100 G T 11: 120,377,030 H306N possibly damaging Het
Fam8a1 T A 13: 46,673,578 I275K probably damaging Het
Fat3 C A 9: 15,999,274 V1811L probably benign Het
Fbn2 C T 18: 58,058,431 C1540Y probably damaging Het
Ffar3 A G 7: 30,855,364 L177P probably damaging Het
Fsip1 T C 2: 118,240,471 E246G probably damaging Het
Gemin4 A G 11: 76,210,779 L1052P probably damaging Het
Gp2 C T 7: 119,442,787 C505Y probably benign Het
Grm5 A T 7: 88,074,538 I679F probably damaging Het
Hapln1 A T 13: 89,584,783 D21V probably benign Het
Jak2 T C 19: 29,284,870 S364P probably damaging Het
Kansl3 A G 1: 36,348,816 probably null Het
Kntc1 T C 5: 123,786,930 L1102S probably benign Het
Mbd3l2 A G 9: 18,444,483 I35V probably benign Het
Mdfic G T 6: 15,799,654 C260F probably damaging Het
Mroh2b T C 15: 4,944,326 S1109P probably benign Het
Myocd A T 11: 65,187,132 C612* probably null Het
Olfr1053 A T 2: 86,315,107 Y60N probably damaging Het
Olfr1189 A G 2: 88,592,091 M96V probably benign Het
Olfr1293-ps T A 2: 111,527,519 C86* probably null Het
Olfr142 A T 2: 90,252,217 M257K possibly damaging Het
Olfr153 A T 2: 87,532,347 T105S probably benign Het
Olfr652 T A 7: 104,564,224 M1K probably null Het
Pard3 C T 8: 127,324,068 R204W probably damaging Het
Per1 T A 11: 69,107,556 N1031K possibly damaging Het
Plekhh3 A G 11: 101,164,279 S583P unknown Het
Pramef8 C T 4: 143,416,868 T68I probably benign Het
Prex2 T A 1: 11,199,894 C1268S possibly damaging Het
Prpf6 T C 2: 181,650,158 I756T probably benign Het
Pum2 T C 12: 8,709,454 V98A probably damaging Het
Rad50 A T 11: 53,684,141 S652T probably benign Het
Rfng G T 11: 120,784,075 P30T unknown Het
Rfx7 T C 9: 72,617,691 I721T probably benign Het
Rpf1 G T 3: 146,507,676 T240K probably benign Het
Ryr3 T C 2: 112,652,925 N4189S probably benign Het
Samd15 G C 12: 87,201,438 R299T probably benign Het
Scn3a A G 2: 65,498,991 M765T possibly damaging Het
Scn9a G A 2: 66,494,622 S1396L probably damaging Het
Sec24a C T 11: 51,743,778 R107Q probably benign Het
Sema4b T A 7: 80,220,819 V505E probably damaging Het
Siglec1 T A 2: 131,078,578 T769S possibly damaging Het
Sit1 T C 4: 43,483,168 E69G possibly damaging Het
Slc12a8 C A 16: 33,550,951 D121E probably benign Het
Slc30a10 A T 1: 185,455,467 Q135L probably benign Het
Suox A G 10: 128,671,331 V276A probably benign Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tmed5 A G 5: 108,125,957 W139R probably damaging Het
Tnks1bp1 C T 2: 85,062,882 T389I possibly damaging Het
Vmn1r65 A T 7: 6,008,257 I326K probably benign Het
Vmn2r43 A G 7: 8,253,602 S421P possibly damaging Het
Vmn2r57 A T 7: 41,427,544 N399K possibly damaging Het
Vmn2r90 T A 17: 17,712,865 L229* probably null Het
Vwf A T 6: 125,679,302 D2610V Het
Zfp646 C T 7: 127,883,910 S1753L probably benign Het
Zfy2 C A Y: 2,107,096 V513F possibly damaging Het
Zranb2 A T 3: 157,546,094 I317F unknown Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R4996:Fmnl1 UTSW 11 103182656 missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8507:Fmnl1 UTSW 11 103194033 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTGTTATGAACCACCCAGC -3'
(R):5'- TCTCCACATGCCCTATCAGAGG -3'

Sequencing Primer
(F):5'- CCTGTGTCAATGAGATCGCTCTAAG -3'
(R):5'- AGGCTACAATTTCTGGCAGC -3'
Posted On2020-09-02