Incidental Mutation 'R8346:Olfr350'
ID 645215
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
MMRRC Submission
Accession Numbers

Genbank: NM_146627; MGI: 3030184
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R8346 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36850339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 98 (I98V)
Ref Sequence ENSEMBL: ENSMUSP00000150158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect probably benign
Transcript: ENSMUST00000055130
AA Change: I98V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: I98V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214457
AA Change: I98V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000215100
AA Change: I98V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik A G 14: 59,142,772 S26P probably damaging Het
Aco1 T A 4: 40,177,876 M299K probably damaging Het
Acox1 G T 11: 116,178,273 T382N possibly damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
App G T 16: 85,103,257 R102S unknown Het
Chd1l T C 3: 97,562,643 N856D probably benign Het
Col11a1 A G 3: 114,212,169 D1650G unknown Het
Cx3cl1 T C 8: 94,780,540 V391A probably damaging Het
Cyp11b2 T C 15: 74,851,768 Y378C probably damaging Het
Cyp26b1 T C 6: 84,577,168 S156G probably benign Het
Cyp3a11 C T 5: 145,858,802 M446I probably damaging Het
D7Ertd443e G A 7: 134,348,756 T396I possibly damaging Het
Dusp4 C A 8: 34,807,938 N70K possibly damaging Het
Dync1h1 G A 12: 110,665,792 A4499T probably benign Het
Eno2 T C 6: 124,763,795 D266G possibly damaging Het
Eomes T C 9: 118,484,968 S694P probably benign Het
Fam105a A G 15: 27,664,558 Y76H probably damaging Het
Fam71f1 G A 6: 29,334,031 C296Y probably damaging Het
Fmo4 A G 1: 162,794,223 V473A probably benign Het
Fmo5 T A 3: 97,645,646 N303K probably damaging Het
Gdf10 A G 14: 33,931,845 E103G probably benign Het
Gjb6 T C 14: 57,124,802 M1V probably null Het
Gm17067 A G 7: 42,708,649 L143P probably damaging Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hmgn3 T C 9: 83,111,106 K50E probably damaging Het
Hoxc11 G A 15: 102,954,751 G76S possibly damaging Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ighv2-2 A T 12: 113,588,569 C16* probably null Het
Kidins220 T G 12: 25,036,534 F989C probably damaging Het
Krtap28-13 A G 1: 83,061,365 K124E unknown Het
Mast4 A G 13: 102,751,478 V1141A probably damaging Het
Myb A T 10: 21,126,237 M735K probably benign Het
Myo3a T A 2: 22,558,422 probably null Het
Naa60 G A 16: 3,900,643 G113D probably damaging Het
Nfatc1 T C 18: 80,682,167 I461V probably benign Het
Nphp4 C A 4: 152,561,321 A1262D probably damaging Het
Obscn A T 11: 59,085,181 V2040E possibly damaging Het
Olfr459 A G 6: 41,772,123 Y59H probably damaging Het
Ormdl1 T A 1: 53,305,467 F63I possibly damaging Het
Phc1 C T 6: 122,325,815 V250M probably damaging Het
Pik3c2b G A 1: 133,090,246 V949M probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prmt8 T A 6: 127,711,847 M187L probably damaging Het
Ptpn3 T C 4: 57,225,547 I513V probably damaging Het
Rad17 A C 13: 100,645,173 S39A possibly damaging Het
Rbck1 T C 2: 152,318,780 Y412C probably damaging Het
Rfc3 C A 5: 151,645,635 M152I probably damaging Het
Scn11a C A 9: 119,778,981 C1028F probably damaging Het
Sfmbt2 C A 2: 10,461,425 P357Q probably damaging Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Stmnd1 A G 13: 46,299,460 N204S probably benign Het
Tdrd1 T C 19: 56,842,267 V244A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r25 T C 6: 123,825,391 T518A probably benign Het
Xdh T C 17: 73,913,943 D597G probably damaging Het
Zfp457 G A 13: 67,293,798 Q238* probably null Het
Zfp647 T C 15: 76,911,728 D244G probably damaging Het
Zfp870 T A 17: 32,883,869 E162V possibly damaging Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0557:Olfr350 UTSW 2 36850748 missense possibly damaging 0.95
R0665:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2107:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5134:Olfr350 UTSW 2 36850476 missense probably benign 0.03
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7258:Olfr350 UTSW 2 36850340 missense probably damaging 0.99
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8692:Olfr350 UTSW 2 36850084 missense probably benign 0.00
R9120:Olfr350 UTSW 2 36850131 nonsense probably null
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAACTGTGCTGGGGAAC -3'
(R):5'- GTTGTCAGCACAGAAGGATAGC -3'

Sequencing Primer
(F):5'- GGAACCTGCTCATCATCCTAC -3'
(R):5'- CACAGAAGGATAGCCGGGCC -3'
Posted On 2020-09-02