Incidental Mutation 'R0030:Foxi2'
ID64523
Institutional Source Beutler Lab
Gene Symbol Foxi2
Ensembl Gene ENSMUSG00000048377
Gene Nameforkhead box I2
SynonymsB130055A05Rik
MMRRC Submission 038324-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0030 (G1)
Quality Score135
Status Not validated
Chromosome7
Chromosomal Location135410308-135413622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135411616 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 192 (T192A)
Ref Sequence ENSEMBL: ENSMUSP00000053641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060356]
Predicted Effect probably damaging
Transcript: ENSMUST00000060356
AA Change: T192A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053641
Gene: ENSMUSG00000048377
AA Change: T192A

DomainStartEndE-ValueType
low complexity region 64 82 N/A INTRINSIC
low complexity region 87 108 N/A INTRINSIC
FH 115 205 1.29e-58 SMART
low complexity region 207 213 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
low complexity region 262 278 N/A INTRINSIC
Meta Mutation Damage Score 0.2940 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T A 1: 89,888,744 Y755* probably null Het
Ahctf1 G A 1: 179,752,436 T2067M probably damaging Het
Ank1 C A 8: 23,093,893 D337E probably damaging Het
Ankrd65 A C 4: 155,791,485 R72S probably damaging Het
Cacna1s T C 1: 136,094,989 probably null Het
Cyp4f40 T C 17: 32,675,973 S462P probably damaging Het
Dxo A G 17: 34,837,938 R132G probably damaging Het
Eps15l1 A G 8: 72,373,050 S646P probably benign Het
Fry T A 5: 150,372,569 C480* probably null Het
Gak C T 5: 108,613,547 W206* probably null Het
Ggt7 G T 2: 155,506,488 D5E probably benign Het
Hectd4 G T 5: 121,262,588 G339* probably null Het
Ikzf3 T C 11: 98,467,612 T300A probably benign Het
Med12l T G 3: 59,248,655 L1198R probably damaging Het
Odf4 T A 11: 68,926,941 E9D probably benign Het
Olfr1395 T A 11: 49,149,040 M261K possibly damaging Het
Pax1 C A 2: 147,368,582 F412L probably damaging Het
Polg A T 7: 79,452,128 I1006N probably damaging Het
Ppp4c A G 7: 126,788,433 V51A possibly damaging Het
Scn10a G C 9: 119,669,990 T304R probably benign Het
Scp2 T A 4: 108,107,690 probably null Het
Ubr4 G T 4: 139,426,793 V2104L probably damaging Het
Other mutations in Foxi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Foxi2 APN 7 135412007 missense probably benign 0.07
IGL02984:Foxi2 UTSW 7 135410398 missense possibly damaging 0.96
R0030:Foxi2 UTSW 7 135411616 missense probably damaging 0.99
R0121:Foxi2 UTSW 7 135411911 missense probably benign
R0830:Foxi2 UTSW 7 135411730 missense probably benign
R2059:Foxi2 UTSW 7 135410677 missense probably damaging 1.00
R3615:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R3616:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R4021:Foxi2 UTSW 7 135410530 missense probably damaging 1.00
R4764:Foxi2 UTSW 7 135410667 missense probably damaging 1.00
R5048:Foxi2 UTSW 7 135411635 missense probably damaging 1.00
R5257:Foxi2 UTSW 7 135410527 missense probably benign 0.19
R5258:Foxi2 UTSW 7 135410527 missense probably benign 0.19
R5561:Foxi2 UTSW 7 135411647 missense probably damaging 1.00
R5611:Foxi2 UTSW 7 135411704 missense probably benign 0.00
R5667:Foxi2 UTSW 7 135410939 splice site probably null
R7492:Foxi2 UTSW 7 135410572 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGCACCCAAATTCTTGCAGTC -3'
(R):5'- AAAAGTCATGGGCCAGACCATCAG -3'

Sequencing Primer
(F):5'- GCAGTCTGACTGTGGAGG -3'
(R):5'- CAAGTAGTGGTGGCCTCAGAC -3'
Posted On2013-08-06