Incidental Mutation 'R8346:Dusp4'
ID645236
Institutional Source Beutler Lab
Gene Symbol Dusp4
Ensembl Gene ENSMUSG00000031530
Gene Namedual specificity phosphatase 4
SynonymsMKP2, E130306H24Rik, 2700078F24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R8346 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location34807297-34819894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34807938 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 70 (N70K)
Ref Sequence ENSEMBL: ENSMUSP00000033930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033930
AA Change: N70K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033930
Gene: ENSMUSG00000031530
AA Change: N70K

DomainStartEndE-ValueType
RHOD 35 160 4.16e-15 SMART
DSPc 199 337 2.91e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a decrease in B cell apoptosis of bone marrow-derived, IL-7-dependent pro-B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik A G 14: 59,142,772 S26P probably damaging Het
Aco1 T A 4: 40,177,876 M299K probably damaging Het
Acox1 G T 11: 116,178,273 T382N possibly damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
App G T 16: 85,103,257 R102S unknown Het
Chd1l T C 3: 97,562,643 N856D probably benign Het
Col11a1 A G 3: 114,212,169 D1650G unknown Het
Cx3cl1 T C 8: 94,780,540 V391A probably damaging Het
Cyp11b2 T C 15: 74,851,768 Y378C probably damaging Het
Cyp26b1 T C 6: 84,577,168 S156G probably benign Het
Cyp3a11 C T 5: 145,858,802 M446I probably damaging Het
D7Ertd443e G A 7: 134,348,756 T396I possibly damaging Het
Dync1h1 G A 12: 110,665,792 A4499T probably benign Het
Eno2 T C 6: 124,763,795 D266G possibly damaging Het
Eomes T C 9: 118,484,968 S694P probably benign Het
Fam105a A G 15: 27,664,558 Y76H probably damaging Het
Fam71f1 G A 6: 29,334,031 C296Y probably damaging Het
Fmo4 A G 1: 162,794,223 V473A probably benign Het
Fmo5 T A 3: 97,645,646 N303K probably damaging Het
Gdf10 A G 14: 33,931,845 E103G probably benign Het
Gjb6 T C 14: 57,124,802 M1V probably null Het
Gm17067 A G 7: 42,708,649 L143P probably damaging Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hmgn3 T C 9: 83,111,106 K50E probably damaging Het
Hoxc11 G A 15: 102,954,751 G76S possibly damaging Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ighv2-2 A T 12: 113,588,569 C16* probably null Het
Kidins220 T G 12: 25,036,534 F989C probably damaging Het
Krtap28-13 A G 1: 83,061,365 K124E unknown Het
Mast4 A G 13: 102,751,478 V1141A probably damaging Het
Myb A T 10: 21,126,237 M735K probably benign Het
Myo3a T A 2: 22,558,422 probably null Het
Naa60 G A 16: 3,900,643 G113D probably damaging Het
Nfatc1 T C 18: 80,682,167 I461V probably benign Het
Nphp4 C A 4: 152,561,321 A1262D probably damaging Het
Obscn A T 11: 59,085,181 V2040E possibly damaging Het
Olfr350 A G 2: 36,850,339 I98V probably benign Het
Olfr459 A G 6: 41,772,123 Y59H probably damaging Het
Ormdl1 T A 1: 53,305,467 F63I possibly damaging Het
Phc1 C T 6: 122,325,815 V250M probably damaging Het
Pik3c2b G A 1: 133,090,246 V949M probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prmt8 T A 6: 127,711,847 M187L probably damaging Het
Ptpn3 T C 4: 57,225,547 I513V probably damaging Het
Rad17 A C 13: 100,645,173 S39A possibly damaging Het
Rbck1 T C 2: 152,318,780 Y412C probably damaging Het
Rfc3 C A 5: 151,645,635 M152I probably damaging Het
Scn11a C A 9: 119,778,981 C1028F probably damaging Het
Sfmbt2 C A 2: 10,461,425 P357Q probably damaging Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Stmnd1 A G 13: 46,299,460 N204S probably benign Het
Tdrd1 T C 19: 56,842,267 V244A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r25 T C 6: 123,825,391 T518A probably benign Het
Xdh T C 17: 73,913,943 D597G probably damaging Het
Zfp457 G A 13: 67,293,798 Q238* probably null Het
Zfp647 T C 15: 76,911,728 D244G probably damaging Het
Zfp870 T A 17: 32,883,869 E162V possibly damaging Het
Other mutations in Dusp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Dusp4 APN 8 34818512 missense probably benign 0.35
IGL02948:Dusp4 APN 8 34818572 missense probably damaging 1.00
R1537:Dusp4 UTSW 8 34818416 missense probably benign 0.00
R1644:Dusp4 UTSW 8 34818479 missense probably damaging 1.00
R4492:Dusp4 UTSW 8 34807736 missense possibly damaging 0.56
R4826:Dusp4 UTSW 8 34818517 missense probably damaging 1.00
R5396:Dusp4 UTSW 8 34817304 missense probably damaging 1.00
R5637:Dusp4 UTSW 8 34817297 missense probably damaging 1.00
R6850:Dusp4 UTSW 8 34816497 nonsense probably null
R7078:Dusp4 UTSW 8 34807911 missense probably damaging 0.99
RF012:Dusp4 UTSW 8 34807799 small deletion probably benign
Z1177:Dusp4 UTSW 8 34808090 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCAAAAGGCTGATGAACCGG -3'
(R):5'- TTAAGCAGGCAGATGTCCGTG -3'

Sequencing Primer
(F):5'- CTGATGAACCGGGATGAGAAC -3'
(R):5'- AGATGTCCGTGCGCTCC -3'
Posted On2020-09-02