Incidental Mutation 'R8346:Scn11a'
ID645241
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R8346 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119778981 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1028 (C1028F)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: C1028F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: C1028F

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: C1028F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik A G 14: 59,142,772 S26P probably damaging Het
Aco1 T A 4: 40,177,876 M299K probably damaging Het
Acox1 G T 11: 116,178,273 T382N possibly damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
App G T 16: 85,103,257 R102S unknown Het
Chd1l T C 3: 97,562,643 N856D probably benign Het
Col11a1 A G 3: 114,212,169 D1650G unknown Het
Cx3cl1 T C 8: 94,780,540 V391A probably damaging Het
Cyp11b2 T C 15: 74,851,768 Y378C probably damaging Het
Cyp26b1 T C 6: 84,577,168 S156G probably benign Het
Cyp3a11 C T 5: 145,858,802 M446I probably damaging Het
D7Ertd443e G A 7: 134,348,756 T396I possibly damaging Het
Dusp4 C A 8: 34,807,938 N70K possibly damaging Het
Dync1h1 G A 12: 110,665,792 A4499T probably benign Het
Eno2 T C 6: 124,763,795 D266G possibly damaging Het
Eomes T C 9: 118,484,968 S694P probably benign Het
Fam105a A G 15: 27,664,558 Y76H probably damaging Het
Fam71f1 G A 6: 29,334,031 C296Y probably damaging Het
Fmo4 A G 1: 162,794,223 V473A probably benign Het
Fmo5 T A 3: 97,645,646 N303K probably damaging Het
Gdf10 A G 14: 33,931,845 E103G probably benign Het
Gjb6 T C 14: 57,124,802 M1V probably null Het
Gm17067 A G 7: 42,708,649 L143P probably damaging Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hmgn3 T C 9: 83,111,106 K50E probably damaging Het
Hoxc11 G A 15: 102,954,751 G76S possibly damaging Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ighv2-2 A T 12: 113,588,569 C16* probably null Het
Kidins220 T G 12: 25,036,534 F989C probably damaging Het
Krtap28-13 A G 1: 83,061,365 K124E unknown Het
Mast4 A G 13: 102,751,478 V1141A probably damaging Het
Myb A T 10: 21,126,237 M735K probably benign Het
Myo3a T A 2: 22,558,422 probably null Het
Naa60 G A 16: 3,900,643 G113D probably damaging Het
Nfatc1 T C 18: 80,682,167 I461V probably benign Het
Nphp4 C A 4: 152,561,321 A1262D probably damaging Het
Obscn A T 11: 59,085,181 V2040E possibly damaging Het
Olfr350 A G 2: 36,850,339 I98V probably benign Het
Olfr459 A G 6: 41,772,123 Y59H probably damaging Het
Ormdl1 T A 1: 53,305,467 F63I possibly damaging Het
Phc1 C T 6: 122,325,815 V250M probably damaging Het
Pik3c2b G A 1: 133,090,246 V949M probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prmt8 T A 6: 127,711,847 M187L probably damaging Het
Ptpn3 T C 4: 57,225,547 I513V probably damaging Het
Rad17 A C 13: 100,645,173 S39A possibly damaging Het
Rbck1 T C 2: 152,318,780 Y412C probably damaging Het
Rfc3 C A 5: 151,645,635 M152I probably damaging Het
Sfmbt2 C A 2: 10,461,425 P357Q probably damaging Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Stmnd1 A G 13: 46,299,460 N204S probably benign Het
Tdrd1 T C 19: 56,842,267 V244A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r25 T C 6: 123,825,391 T518A probably benign Het
Xdh T C 17: 73,913,943 D597G probably damaging Het
Zfp457 G A 13: 67,293,798 Q238* probably null Het
Zfp647 T C 15: 76,911,728 D244G probably damaging Het
Zfp870 T A 17: 32,883,869 E162V possibly damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8511:Scn11a UTSW 9 119789915 missense probably damaging 0.99
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAACACCCTCCCTTTG -3'
(R):5'- TGCAGTTCACAAGGCAAGGG -3'

Sequencing Primer
(F):5'- TCCAAGAGCATCCTTTACCAGTG -3'
(R):5'- TTCACAAGGCAAGGGACATG -3'
Posted On2020-09-02