Incidental Mutation 'R8346:Xdh'
ID645265
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R8346 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73913943 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 597 (D597G)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: D597G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: D597G

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik A G 14: 59,142,772 S26P probably damaging Het
Aco1 T A 4: 40,177,876 M299K probably damaging Het
Acox1 G T 11: 116,178,273 T382N possibly damaging Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
App G T 16: 85,103,257 R102S unknown Het
Chd1l T C 3: 97,562,643 N856D probably benign Het
Col11a1 A G 3: 114,212,169 D1650G unknown Het
Cx3cl1 T C 8: 94,780,540 V391A probably damaging Het
Cyp11b2 T C 15: 74,851,768 Y378C probably damaging Het
Cyp26b1 T C 6: 84,577,168 S156G probably benign Het
Cyp3a11 C T 5: 145,858,802 M446I probably damaging Het
D7Ertd443e G A 7: 134,348,756 T396I possibly damaging Het
Dusp4 C A 8: 34,807,938 N70K possibly damaging Het
Dync1h1 G A 12: 110,665,792 A4499T probably benign Het
Eno2 T C 6: 124,763,795 D266G possibly damaging Het
Eomes T C 9: 118,484,968 S694P probably benign Het
Fam105a A G 15: 27,664,558 Y76H probably damaging Het
Fam71f1 G A 6: 29,334,031 C296Y probably damaging Het
Fmo4 A G 1: 162,794,223 V473A probably benign Het
Fmo5 T A 3: 97,645,646 N303K probably damaging Het
Gdf10 A G 14: 33,931,845 E103G probably benign Het
Gjb6 T C 14: 57,124,802 M1V probably null Het
Gm17067 A G 7: 42,708,649 L143P probably damaging Het
Helz A G 11: 107,672,573 D1613G unknown Het
Hmgn3 T C 9: 83,111,106 K50E probably damaging Het
Hoxc11 G A 15: 102,954,751 G76S possibly damaging Het
Ighv1-9 A T 12: 114,583,828 M31K probably benign Het
Ighv2-2 A T 12: 113,588,569 C16* probably null Het
Kidins220 T G 12: 25,036,534 F989C probably damaging Het
Krtap28-13 A G 1: 83,061,365 K124E unknown Het
Mast4 A G 13: 102,751,478 V1141A probably damaging Het
Myb A T 10: 21,126,237 M735K probably benign Het
Myo3a T A 2: 22,558,422 probably null Het
Naa60 G A 16: 3,900,643 G113D probably damaging Het
Nfatc1 T C 18: 80,682,167 I461V probably benign Het
Nphp4 C A 4: 152,561,321 A1262D probably damaging Het
Obscn A T 11: 59,085,181 V2040E possibly damaging Het
Olfr350 A G 2: 36,850,339 I98V probably benign Het
Olfr459 A G 6: 41,772,123 Y59H probably damaging Het
Ormdl1 T A 1: 53,305,467 F63I possibly damaging Het
Phc1 C T 6: 122,325,815 V250M probably damaging Het
Pik3c2b G A 1: 133,090,246 V949M probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prmt8 T A 6: 127,711,847 M187L probably damaging Het
Ptpn3 T C 4: 57,225,547 I513V probably damaging Het
Rad17 A C 13: 100,645,173 S39A possibly damaging Het
Rbck1 T C 2: 152,318,780 Y412C probably damaging Het
Rfc3 C A 5: 151,645,635 M152I probably damaging Het
Scn11a C A 9: 119,778,981 C1028F probably damaging Het
Sfmbt2 C A 2: 10,461,425 P357Q probably damaging Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Stmnd1 A G 13: 46,299,460 N204S probably benign Het
Tdrd1 T C 19: 56,842,267 V244A probably benign Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Vmn2r25 T C 6: 123,825,391 T518A probably benign Het
Zfp457 G A 13: 67,293,798 Q238* probably null Het
Zfp647 T C 15: 76,911,728 D244G probably damaging Het
Zfp870 T A 17: 32,883,869 E162V possibly damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCGTGCCTGAACTCTTC -3'
(R):5'- GTTCCTGACATCTCTAGGGC -3'

Sequencing Primer
(F):5'- CTTCCTGTCTCTATTCTAGAATGGGG -3'
(R):5'- CTGACATCTCTAGGGCCTATAGAG -3'
Posted On2020-09-02