Incidental Mutation 'R8346:Xdh'
ID 645265
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 067802-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R8346 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74220938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 597 (D597G)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: D597G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: D597G

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik A G 14: 59,380,221 (GRCm39) S26P probably damaging Het
Aco1 T A 4: 40,177,876 (GRCm39) M299K probably damaging Het
Acox1 G T 11: 116,069,099 (GRCm39) T382N possibly damaging Het
Angpt2 G A 8: 18,791,135 (GRCm39) R54* probably null Het
App G T 16: 84,900,145 (GRCm39) R102S unknown Het
Chd1l T C 3: 97,469,959 (GRCm39) N856D probably benign Het
Col11a1 A G 3: 114,005,818 (GRCm39) D1650G unknown Het
Cx3cl1 T C 8: 95,507,168 (GRCm39) V391A probably damaging Het
Cyp11b2 T C 15: 74,723,617 (GRCm39) Y378C probably damaging Het
Cyp26b1 T C 6: 84,554,150 (GRCm39) S156G probably benign Het
Cyp3a11 C T 5: 145,795,612 (GRCm39) M446I probably damaging Het
D7Ertd443e G A 7: 133,950,485 (GRCm39) T396I possibly damaging Het
Dusp4 C A 8: 35,275,092 (GRCm39) N70K possibly damaging Het
Dync1h1 G A 12: 110,632,226 (GRCm39) A4499T probably benign Het
Eno2 T C 6: 124,740,758 (GRCm39) D266G possibly damaging Het
Eomes T C 9: 118,314,036 (GRCm39) S694P probably benign Het
Fmo4 A G 1: 162,621,792 (GRCm39) V473A probably benign Het
Fmo5 T A 3: 97,552,962 (GRCm39) N303K probably damaging Het
Garin1b G A 6: 29,334,030 (GRCm39) C296Y probably damaging Het
Gdf10 A G 14: 33,653,802 (GRCm39) E103G probably benign Het
Gjb6 T C 14: 57,362,259 (GRCm39) M1V probably null Het
Gm17067 A G 7: 42,358,073 (GRCm39) L143P probably damaging Het
Helz A G 11: 107,563,399 (GRCm39) D1613G unknown Het
Hmgn3 T C 9: 82,993,159 (GRCm39) K50E probably damaging Het
Hoxc11 G A 15: 102,863,186 (GRCm39) G76S possibly damaging Het
Ighv1-9 A T 12: 114,547,448 (GRCm39) M31K probably benign Het
Ighv2-2 A T 12: 113,552,189 (GRCm39) C16* probably null Het
Kidins220 T G 12: 25,086,533 (GRCm39) F989C probably damaging Het
Krtap28-13 A G 1: 83,039,086 (GRCm39) K124E unknown Het
Mast4 A G 13: 102,887,986 (GRCm39) V1141A probably damaging Het
Myb A T 10: 21,002,136 (GRCm39) M735K probably benign Het
Myo3a T A 2: 22,448,434 (GRCm39) probably null Het
Naa60 G A 16: 3,718,507 (GRCm39) G113D probably damaging Het
Nfatc1 T C 18: 80,725,382 (GRCm39) I461V probably benign Het
Nphp4 C A 4: 152,645,778 (GRCm39) A1262D probably damaging Het
Obscn A T 11: 58,976,007 (GRCm39) V2040E possibly damaging Het
Or1j4 A G 2: 36,740,351 (GRCm39) I98V probably benign Het
Or9a2 A G 6: 41,749,057 (GRCm39) Y59H probably damaging Het
Ormdl1 T A 1: 53,344,626 (GRCm39) F63I possibly damaging Het
Otulinl A G 15: 27,664,644 (GRCm39) Y76H probably damaging Het
Phc1 C T 6: 122,302,774 (GRCm39) V250M probably damaging Het
Pik3c2b G A 1: 133,017,984 (GRCm39) V949M probably damaging Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Prmt8 T A 6: 127,688,810 (GRCm39) M187L probably damaging Het
Ptpn3 T C 4: 57,225,547 (GRCm39) I513V probably damaging Het
Rad17 A C 13: 100,781,681 (GRCm39) S39A possibly damaging Het
Rbck1 T C 2: 152,160,700 (GRCm39) Y412C probably damaging Het
Rfc3 C A 5: 151,569,100 (GRCm39) M152I probably damaging Het
Scn11a C A 9: 119,608,047 (GRCm39) C1028F probably damaging Het
Sfmbt2 C A 2: 10,466,236 (GRCm39) P357Q probably damaging Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Stmnd1 A G 13: 46,452,936 (GRCm39) N204S probably benign Het
Tdrd1 T C 19: 56,830,699 (GRCm39) V244A probably benign Het
Ttc28 G A 5: 111,381,207 (GRCm39) D1240N probably benign Het
Vmn2r25 T C 6: 123,802,350 (GRCm39) T518A probably benign Het
Zfp457 G A 13: 67,441,862 (GRCm39) Q238* probably null Het
Zfp647 T C 15: 76,795,928 (GRCm39) D244G probably damaging Het
Zfp870 T A 17: 33,102,843 (GRCm39) E162V possibly damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCGTGCCTGAACTCTTC -3'
(R):5'- GTTCCTGACATCTCTAGGGC -3'

Sequencing Primer
(F):5'- CTTCCTGTCTCTATTCTAGAATGGGG -3'
(R):5'- CTGACATCTCTAGGGCCTATAGAG -3'
Posted On 2020-09-02