Incidental Mutation 'R8347:Dbi'
ID 645269
Institutional Source Beutler Lab
Gene Symbol Dbi
Ensembl Gene ENSMUSG00000026385
Gene Name diazepam binding inhibitor
Synonyms Acbp, diazepam-binding inhibitor, EP, endozepine
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 120113280-120121078 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 120120820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 32 (L32R)
Ref Sequence ENSEMBL: ENSMUSP00000114705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027634] [ENSMUST00000027637] [ENSMUST00000056038] [ENSMUST00000112644] [ENSMUST00000112648] [ENSMUST00000132118] [ENSMUST00000151708]
AlphaFold P31786
Predicted Effect probably benign
Transcript: ENSMUST00000027634
SMART Domains Protein: ENSMUSP00000027634
Gene: ENSMUSG00000026385

DomainStartEndE-ValueType
Pfam:ACBP 3 83 1.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027637
SMART Domains Protein: ENSMUSP00000027637
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056038
SMART Domains Protein: ENSMUSP00000053335
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112644
SMART Domains Protein: ENSMUSP00000108263
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 126 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112648
SMART Domains Protein: ENSMUSP00000108267
Gene: ENSMUSG00000026385

DomainStartEndE-ValueType
Pfam:ACBP 1 62 2.6e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132118
SMART Domains Protein: ENSMUSP00000138014
Gene: ENSMUSG00000026385

DomainStartEndE-ValueType
Pfam:ACBP 2 70 7.9e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151708
AA Change: L32R

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114705
Gene: ENSMUSG00000026385
AA Change: L32R

DomainStartEndE-ValueType
Pfam:ACBP 50 134 1.3e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal fur and skin morphology at P16 and impaired metabolic changes at weaning with reduced growth and hepatic cholesterol synthesis. Mice homozygous for a different knock-out allele complete exhibit embryonic lethality around implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Dbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Dbi APN 1 120113477 missense probably benign 0.06
PIT4581001:Dbi UTSW 1 120119912 missense probably damaging 0.96
R2964:Dbi UTSW 1 120120116 intron probably benign
R4483:Dbi UTSW 1 120120805 missense probably benign 0.00
R5935:Dbi UTSW 1 120120853 missense probably benign 0.41
R7357:Dbi UTSW 1 120119893 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATTCGGTTCTTCCCAGTGTGG -3'
(R):5'- GTGCTTTTAAAGGCGCTAGC -3'

Sequencing Primer
(F):5'- CCAGTGTGGGATTCAATCTTCC -3'
(R):5'- TAAAGGCGCTAGCTGGTGC -3'
Posted On 2020-09-02