Incidental Mutation 'R8347:Or4b1b'
ID 645277
Institutional Source Beutler Lab
Gene Symbol Or4b1b
Ensembl Gene ENSMUSG00000075061
Gene Name olfactory receptor family 4 subfamily B member 1B
Synonyms Olfr1272, GA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 90111991-90112917 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90112020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 300 (W300R)
Ref Sequence ENSEMBL: ENSMUSP00000150745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]
AlphaFold Q8VGN8
Predicted Effect probably benign
Transcript: ENSMUST00000099750
AA Change: W300R

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: W300R

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.5e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.5e-5 PFAM
Pfam:7tm_1 39 285 1.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117141
AA Change: W300R

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Or4b1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Or4b1b APN 2 90,112,425 (GRCm39) missense possibly damaging 0.55
IGL01824:Or4b1b APN 2 90,112,263 (GRCm39) missense probably damaging 1.00
IGL01951:Or4b1b APN 2 90,112,351 (GRCm39) missense probably damaging 1.00
IGL02473:Or4b1b APN 2 90,112,040 (GRCm39) missense probably null 1.00
IGL02494:Or4b1b APN 2 90,112,295 (GRCm39) missense probably benign 0.35
IGL03410:Or4b1b APN 2 90,112,557 (GRCm39) missense probably damaging 1.00
R0350:Or4b1b UTSW 2 90,112,926 (GRCm39) splice site probably null
R0363:Or4b1b UTSW 2 90,112,200 (GRCm39) missense probably damaging 1.00
R0401:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R0666:Or4b1b UTSW 2 90,112,212 (GRCm39) missense probably damaging 0.96
R1860:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R1861:Or4b1b UTSW 2 90,112,502 (GRCm39) missense probably damaging 1.00
R2374:Or4b1b UTSW 2 90,112,795 (GRCm39) missense possibly damaging 0.76
R4256:Or4b1b UTSW 2 90,112,406 (GRCm39) missense probably damaging 1.00
R4737:Or4b1b UTSW 2 90,112,725 (GRCm39) missense probably damaging 1.00
R4827:Or4b1b UTSW 2 90,112,547 (GRCm39) missense probably damaging 1.00
R5198:Or4b1b UTSW 2 90,126,737 (GRCm39) missense probably damaging 1.00
R5589:Or4b1b UTSW 2 90,112,313 (GRCm39) missense probably damaging 1.00
R6412:Or4b1b UTSW 2 90,112,202 (GRCm39) missense probably damaging 1.00
R7130:Or4b1b UTSW 2 90,112,266 (GRCm39) missense probably benign
R7317:Or4b1b UTSW 2 90,112,748 (GRCm39) missense probably damaging 1.00
R7497:Or4b1b UTSW 2 90,112,098 (GRCm39) missense possibly damaging 0.74
R7762:Or4b1b UTSW 2 90,126,975 (GRCm39) nonsense probably null
R8271:Or4b1b UTSW 2 90,112,616 (GRCm39) missense possibly damaging 0.74
R8703:Or4b1b UTSW 2 90,126,837 (GRCm39) missense probably damaging 1.00
R8794:Or4b1b UTSW 2 90,112,150 (GRCm39) nonsense probably null
R8824:Or4b1b UTSW 2 90,126,356 (GRCm39) missense probably damaging 0.98
R8910:Or4b1b UTSW 2 90,126,848 (GRCm39) missense possibly damaging 0.80
R8934:Or4b1b UTSW 2 90,112,356 (GRCm39) missense probably benign 0.07
R9548:Or4b1b UTSW 2 90,111,991 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- GGTTACTAGAGAGGTGCAGC -3'
(R):5'- TGCTATCATTCTAATCAGCTTGAGG -3'

Sequencing Primer
(F):5'- GCAGCAGTAGAAGAATGATACTCTTC -3'
(R):5'- GTGCCTCTCACATCACAGTGG -3'
Posted On 2020-09-02