Incidental Mutation 'R8347:Padi6'
ID 645283
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms Padi5, Pad6, ePAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 140727355-140742643 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140735408 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 301 (M301V)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]
AlphaFold Q8K3V4
Predicted Effect probably benign
Transcript: ENSMUST00000038749
AA Change: M301V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: M301V

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130267
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7084:Padi6 UTSW 4 140741558 nonsense probably null
R7533:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R7581:Padi6 UTSW 4 140728929 missense probably benign 0.01
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8333:Padi6 UTSW 4 140737376 missense probably damaging 1.00
R8550:Padi6 UTSW 4 140732703 missense probably benign 0.15
R8979:Padi6 UTSW 4 140739163 missense probably benign 0.03
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCACGACTGGAAGTGTC -3'
(R):5'- ACACTGAAGCTCTCGGTACAG -3'

Sequencing Primer
(F):5'- TGGAAGTGTCCCCACAACTG -3'
(R):5'- AAGCTCTCGGTACAGCTGGG -3'
Posted On 2020-09-02