Incidental Mutation 'R8347:Rint1'
ID 645287
Institutional Source Beutler Lab
Gene Symbol Rint1
Ensembl Gene ENSMUSG00000028999
Gene Name RAD50 interactor 1
Synonyms 1500019C06Rik, 2810450M21Rik
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 23992709-24025367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 24016770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 512 (L512V)
Ref Sequence ENSEMBL: ENSMUSP00000030852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]
AlphaFold Q8BZ36
Predicted Effect probably damaging
Transcript: ENSMUST00000030852
AA Change: L512V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: L512V

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 304 784 2.3e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115113
AA Change: L454V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: L454V

DomainStartEndE-ValueType
Pfam:RINT1_TIP1 246 727 1.2e-161 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Rint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rint1 APN 5 23,999,429 (GRCm39) missense probably benign 0.00
IGL00596:Rint1 APN 5 24,016,863 (GRCm39) missense probably damaging 0.99
IGL01685:Rint1 APN 5 23,992,832 (GRCm39) unclassified probably benign
IGL02428:Rint1 APN 5 23,999,450 (GRCm39) nonsense probably null
IGL03007:Rint1 APN 5 24,020,699 (GRCm39) missense probably benign 0.00
IGL03280:Rint1 APN 5 24,022,076 (GRCm39) missense probably damaging 1.00
breakage UTSW 5 24,005,720 (GRCm39) missense probably damaging 0.99
IGL02799:Rint1 UTSW 5 24,024,478 (GRCm39) missense possibly damaging 0.93
R0062:Rint1 UTSW 5 23,992,826 (GRCm39) unclassified probably benign
R0243:Rint1 UTSW 5 24,021,930 (GRCm39) splice site probably benign
R1102:Rint1 UTSW 5 24,010,565 (GRCm39) splice site probably benign
R1552:Rint1 UTSW 5 24,005,656 (GRCm39) missense probably benign 0.00
R1729:Rint1 UTSW 5 24,014,841 (GRCm39) missense probably benign 0.00
R1784:Rint1 UTSW 5 24,014,841 (GRCm39) missense probably benign 0.00
R2070:Rint1 UTSW 5 24,015,927 (GRCm39) missense possibly damaging 0.94
R2920:Rint1 UTSW 5 24,010,400 (GRCm39) missense probably benign 0.00
R3114:Rint1 UTSW 5 24,024,418 (GRCm39) missense probably benign 0.27
R4398:Rint1 UTSW 5 23,999,445 (GRCm39) missense possibly damaging 0.55
R4756:Rint1 UTSW 5 24,014,791 (GRCm39) missense probably damaging 1.00
R5246:Rint1 UTSW 5 24,005,809 (GRCm39) missense probably damaging 0.99
R5452:Rint1 UTSW 5 23,999,363 (GRCm39) missense probably benign 0.01
R5566:Rint1 UTSW 5 24,015,951 (GRCm39) missense probably damaging 1.00
R5709:Rint1 UTSW 5 24,020,831 (GRCm39) missense probably damaging 0.98
R6524:Rint1 UTSW 5 24,020,737 (GRCm39) missense probably benign 0.00
R7346:Rint1 UTSW 5 24,020,651 (GRCm39) missense possibly damaging 0.82
R7549:Rint1 UTSW 5 24,020,702 (GRCm39) missense probably benign
R7634:Rint1 UTSW 5 24,010,477 (GRCm39) missense probably benign 0.00
R7647:Rint1 UTSW 5 24,005,800 (GRCm39) missense probably damaging 1.00
R7885:Rint1 UTSW 5 24,010,642 (GRCm39) missense probably benign
R7895:Rint1 UTSW 5 24,005,720 (GRCm39) missense probably damaging 0.99
R8791:Rint1 UTSW 5 24,005,594 (GRCm39) missense probably damaging 0.99
R8900:Rint1 UTSW 5 24,016,882 (GRCm39) missense possibly damaging 0.77
R8916:Rint1 UTSW 5 23,992,826 (GRCm39) unclassified probably benign
R8973:Rint1 UTSW 5 24,016,728 (GRCm39) missense probably benign 0.00
R9245:Rint1 UTSW 5 24,010,411 (GRCm39) missense probably benign
R9339:Rint1 UTSW 5 23,993,355 (GRCm39) makesense probably null
R9630:Rint1 UTSW 5 24,020,810 (GRCm39) missense possibly damaging 0.82
R9718:Rint1 UTSW 5 24,005,721 (GRCm39) missense possibly damaging 0.53
Z1088:Rint1 UTSW 5 24,010,312 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTAGTAGAAATCTGTGGCAGTAG -3'
(R):5'- GCAAAGTCAACATTTGAAAGGC -3'

Sequencing Primer
(F):5'- GTAGCCTCACTTTTGATTGAGCCAG -3'
(R):5'- CAAAGTCAACATTTGAAAGGCTAAAG -3'
Posted On 2020-09-02