Incidental Mutation 'R8347:Med13l'
ID 645289
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Name mediator complex subunit 13-like
Synonyms 9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 118560679-118765438 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118742597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1251 (H1251Q)
Ref Sequence ENSEMBL: ENSMUSP00000098379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000100816
AA Change: H1251Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: H1251Q

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201010
AA Change: H1251Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: H1251Q

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118724071 missense probably damaging 0.99
IGL01012:Med13l APN 5 118734028 missense probably damaging 0.99
IGL01316:Med13l APN 5 118762781 missense probably damaging 1.00
IGL01529:Med13l APN 5 118742335 missense probably damaging 1.00
IGL01731:Med13l APN 5 118742407 missense probably benign 0.05
IGL01790:Med13l APN 5 118593522 missense probably damaging 1.00
IGL02394:Med13l APN 5 118748833 missense probably benign 0.37
IGL02432:Med13l APN 5 118738400 missense possibly damaging 0.90
IGL02698:Med13l APN 5 118762829 missense probably damaging 0.99
IGL02801:Med13l APN 5 118745113 missense probably damaging 1.00
IGL03242:Med13l APN 5 118747445 missense probably benign
IGL03270:Med13l APN 5 118731430 missense probably damaging 1.00
Basics UTSW 5 118759264 critical splice donor site probably null
firmament UTSW 5 118745006 splice site probably null
Fundament UTSW 5 118721474 missense probably damaging 1.00
Root UTSW 5 118593445 missense probably damaging 1.00
P0035:Med13l UTSW 5 118742620 missense probably benign 0.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0051:Med13l UTSW 5 118742655 missense probably damaging 1.00
R0136:Med13l UTSW 5 118724050 missense probably benign 0.15
R0158:Med13l UTSW 5 118742449 missense unknown
R0197:Med13l UTSW 5 118671002 splice site probably benign
R0370:Med13l UTSW 5 118741826 missense probably benign 0.14
R0492:Med13l UTSW 5 118738495 missense probably damaging 1.00
R0532:Med13l UTSW 5 118759123 missense possibly damaging 0.78
R0726:Med13l UTSW 5 118748684 missense probably damaging 0.99
R0738:Med13l UTSW 5 118751633 missense probably damaging 0.99
R0827:Med13l UTSW 5 118726247 splice site probably benign
R0883:Med13l UTSW 5 118671002 splice site probably benign
R0959:Med13l UTSW 5 118754285 missense possibly damaging 0.89
R1458:Med13l UTSW 5 118738459 missense probably benign 0.00
R1562:Med13l UTSW 5 118738519 missense probably damaging 1.00
R1577:Med13l UTSW 5 118721392 missense probably damaging 1.00
R1661:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1665:Med13l UTSW 5 118749748 missense probably damaging 1.00
R1720:Med13l UTSW 5 118741995 missense probably damaging 1.00
R1929:Med13l UTSW 5 118728833 missense probably benign 0.01
R1967:Med13l UTSW 5 118761322 missense probably damaging 0.99
R2301:Med13l UTSW 5 118593447 missense probably damaging 1.00
R3691:Med13l UTSW 5 118721497 missense probably benign 0.16
R3895:Med13l UTSW 5 118761323 missense probably null 0.99
R4043:Med13l UTSW 5 118593463 missense probably damaging 1.00
R4593:Med13l UTSW 5 118742560 missense probably damaging 1.00
R4902:Med13l UTSW 5 118745130 missense probably damaging 1.00
R4995:Med13l UTSW 5 118730949 missense possibly damaging 0.90
R5010:Med13l UTSW 5 118593550 missense possibly damaging 0.95
R5057:Med13l UTSW 5 118718493 missense probably damaging 1.00
R5369:Med13l UTSW 5 118724010 missense probably benign 0.02
R5446:Med13l UTSW 5 118742397 missense possibly damaging 0.81
R5564:Med13l UTSW 5 118742040 missense probably damaging 1.00
R5566:Med13l UTSW 5 118728665 missense possibly damaging 0.95
R5580:Med13l UTSW 5 118751630 missense possibly damaging 0.95
R5634:Med13l UTSW 5 118560850 missense possibly damaging 0.88
R5748:Med13l UTSW 5 118593445 missense probably damaging 1.00
R5764:Med13l UTSW 5 118728642 missense probably damaging 0.99
R5765:Med13l UTSW 5 118728642 missense probably damaging 0.99
R6083:Med13l UTSW 5 118721486 missense possibly damaging 0.80
R6504:Med13l UTSW 5 118754321 missense probably benign 0.34
R6546:Med13l UTSW 5 118721474 missense probably damaging 1.00
R6797:Med13l UTSW 5 118759264 critical splice donor site probably null
R6911:Med13l UTSW 5 118755658 missense possibly damaging 0.95
R6942:Med13l UTSW 5 118745006 splice site probably null
R7018:Med13l UTSW 5 118751986 missense probably damaging 0.99
R7096:Med13l UTSW 5 118721926 missense possibly damaging 0.90
R7113:Med13l UTSW 5 118726265 missense probably benign 0.09
R7136:Med13l UTSW 5 118721522 missense possibly damaging 0.90
R7140:Med13l UTSW 5 118741972 missense probably benign 0.27
R7345:Med13l UTSW 5 118742760 missense probably damaging 1.00
R7409:Med13l UTSW 5 118754321 missense probably benign 0.34
R7410:Med13l UTSW 5 118560832 missense possibly damaging 0.94
R7432:Med13l UTSW 5 118751938 missense probably damaging 0.99
R7486:Med13l UTSW 5 118728474 missense probably benign 0.17
R7509:Med13l UTSW 5 118748930 missense probably damaging 0.97
R7722:Med13l UTSW 5 118747407 missense probably benign 0.32
R7802:Med13l UTSW 5 118728590 missense probably benign 0.03
R8081:Med13l UTSW 5 118728268 missense probably damaging 1.00
R8260:Med13l UTSW 5 118748729 missense possibly damaging 0.95
R8266:Med13l UTSW 5 118742109 missense probably damaging 1.00
R8365:Med13l UTSW 5 118728644 missense possibly damaging 0.81
R8508:Med13l UTSW 5 118754321 missense probably benign 0.34
R8920:Med13l UTSW 5 118747478 nonsense probably null
R8970:Med13l UTSW 5 118745099 missense probably damaging 1.00
R8994:Med13l UTSW 5 118728161 missense possibly damaging 0.78
R9045:Med13l UTSW 5 118742751 missense probably benign
R9401:Med13l UTSW 5 118745024 missense probably benign 0.14
R9445:Med13l UTSW 5 118724149 missense probably benign 0.00
R9446:Med13l UTSW 5 118738502 missense probably benign 0.11
R9714:Med13l UTSW 5 118728373 missense probably benign 0.44
R9777:Med13l UTSW 5 118748959 missense probably benign
R9781:Med13l UTSW 5 118729967 missense possibly damaging 0.60
R9797:Med13l UTSW 5 118742079 missense probably damaging 1.00
X0065:Med13l UTSW 5 118729883 missense probably damaging 1.00
Z1088:Med13l UTSW 5 118749641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTGACATCGGCCAAGCTG -3'
(R):5'- AGTCTGTACTCTGGGACACCTAC -3'

Sequencing Primer
(F):5'- CTGCAGAAAGACGCCTGATG -3'
(R):5'- GTACTCTGGGACACCTACCGTTG -3'
Posted On 2020-09-02