Incidental Mutation 'R8347:Med13l'
ID 645289
Institutional Source Beutler Lab
Gene Symbol Med13l
Ensembl Gene ENSMUSG00000018076
Gene Name mediator complex subunit 13-like
Synonyms 9030618F05Rik, Trap240L, 6330591G05Rik, Thrap2, 2210413I17Rik
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 118698744-118903503 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118880662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1251 (H1251Q)
Ref Sequence ENSEMBL: ENSMUSP00000098379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000100816
AA Change: H1251Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: H1251Q

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 2.5e-116 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2197 1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201010
AA Change: H1251Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: H1251Q

DomainStartEndE-ValueType
Pfam:Med13_N 1 380 1e-112 PFAM
low complexity region 442 460 N/A INTRINSIC
low complexity region 542 558 N/A INTRINSIC
low complexity region 1020 1031 N/A INTRINSIC
low complexity region 1044 1060 N/A INTRINSIC
low complexity region 1541 1593 N/A INTRINSIC
low complexity region 1601 1611 N/A INTRINSIC
Pfam:Med13_C 1675 2206 1.7e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Med13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Med13l APN 5 118,862,136 (GRCm39) missense probably damaging 0.99
IGL01012:Med13l APN 5 118,872,093 (GRCm39) missense probably damaging 0.99
IGL01316:Med13l APN 5 118,900,846 (GRCm39) missense probably damaging 1.00
IGL01529:Med13l APN 5 118,880,400 (GRCm39) missense probably damaging 1.00
IGL01731:Med13l APN 5 118,880,472 (GRCm39) missense probably benign 0.05
IGL01790:Med13l APN 5 118,731,587 (GRCm39) missense probably damaging 1.00
IGL02394:Med13l APN 5 118,886,898 (GRCm39) missense probably benign 0.37
IGL02432:Med13l APN 5 118,876,465 (GRCm39) missense possibly damaging 0.90
IGL02698:Med13l APN 5 118,900,894 (GRCm39) missense probably damaging 0.99
IGL02801:Med13l APN 5 118,883,178 (GRCm39) missense probably damaging 1.00
IGL03242:Med13l APN 5 118,885,510 (GRCm39) missense probably benign
IGL03270:Med13l APN 5 118,869,495 (GRCm39) missense probably damaging 1.00
Basics UTSW 5 118,897,329 (GRCm39) critical splice donor site probably null
firmament UTSW 5 118,883,071 (GRCm39) splice site probably null
Fundament UTSW 5 118,859,539 (GRCm39) missense probably damaging 1.00
Root UTSW 5 118,731,510 (GRCm39) missense probably damaging 1.00
P0035:Med13l UTSW 5 118,880,685 (GRCm39) missense probably benign 0.00
R0051:Med13l UTSW 5 118,880,720 (GRCm39) missense probably damaging 1.00
R0051:Med13l UTSW 5 118,880,720 (GRCm39) missense probably damaging 1.00
R0136:Med13l UTSW 5 118,862,115 (GRCm39) missense probably benign 0.15
R0158:Med13l UTSW 5 118,880,514 (GRCm39) missense unknown
R0197:Med13l UTSW 5 118,809,067 (GRCm39) splice site probably benign
R0370:Med13l UTSW 5 118,879,891 (GRCm39) missense probably benign 0.14
R0492:Med13l UTSW 5 118,876,560 (GRCm39) missense probably damaging 1.00
R0532:Med13l UTSW 5 118,897,188 (GRCm39) missense possibly damaging 0.78
R0726:Med13l UTSW 5 118,886,749 (GRCm39) missense probably damaging 0.99
R0738:Med13l UTSW 5 118,889,698 (GRCm39) missense probably damaging 0.99
R0827:Med13l UTSW 5 118,864,312 (GRCm39) splice site probably benign
R0883:Med13l UTSW 5 118,809,067 (GRCm39) splice site probably benign
R0959:Med13l UTSW 5 118,892,350 (GRCm39) missense possibly damaging 0.89
R1458:Med13l UTSW 5 118,876,524 (GRCm39) missense probably benign 0.00
R1562:Med13l UTSW 5 118,876,584 (GRCm39) missense probably damaging 1.00
R1577:Med13l UTSW 5 118,859,457 (GRCm39) missense probably damaging 1.00
R1661:Med13l UTSW 5 118,887,813 (GRCm39) missense probably damaging 1.00
R1665:Med13l UTSW 5 118,887,813 (GRCm39) missense probably damaging 1.00
R1720:Med13l UTSW 5 118,880,060 (GRCm39) missense probably damaging 1.00
R1929:Med13l UTSW 5 118,866,898 (GRCm39) missense probably benign 0.01
R1967:Med13l UTSW 5 118,899,387 (GRCm39) missense probably damaging 0.99
R2301:Med13l UTSW 5 118,731,512 (GRCm39) missense probably damaging 1.00
R3691:Med13l UTSW 5 118,859,562 (GRCm39) missense probably benign 0.16
R3895:Med13l UTSW 5 118,899,388 (GRCm39) missense probably null 0.99
R4043:Med13l UTSW 5 118,731,528 (GRCm39) missense probably damaging 1.00
R4593:Med13l UTSW 5 118,880,625 (GRCm39) missense probably damaging 1.00
R4902:Med13l UTSW 5 118,883,195 (GRCm39) missense probably damaging 1.00
R4995:Med13l UTSW 5 118,869,014 (GRCm39) missense possibly damaging 0.90
R5010:Med13l UTSW 5 118,731,615 (GRCm39) missense possibly damaging 0.95
R5057:Med13l UTSW 5 118,856,558 (GRCm39) missense probably damaging 1.00
R5369:Med13l UTSW 5 118,862,075 (GRCm39) missense probably benign 0.02
R5446:Med13l UTSW 5 118,880,462 (GRCm39) missense possibly damaging 0.81
R5564:Med13l UTSW 5 118,880,105 (GRCm39) missense probably damaging 1.00
R5566:Med13l UTSW 5 118,866,730 (GRCm39) missense possibly damaging 0.95
R5580:Med13l UTSW 5 118,889,695 (GRCm39) missense possibly damaging 0.95
R5634:Med13l UTSW 5 118,698,915 (GRCm39) missense possibly damaging 0.88
R5748:Med13l UTSW 5 118,731,510 (GRCm39) missense probably damaging 1.00
R5764:Med13l UTSW 5 118,866,707 (GRCm39) missense probably damaging 0.99
R5765:Med13l UTSW 5 118,866,707 (GRCm39) missense probably damaging 0.99
R6083:Med13l UTSW 5 118,859,551 (GRCm39) missense possibly damaging 0.80
R6504:Med13l UTSW 5 118,892,386 (GRCm39) missense probably benign 0.34
R6546:Med13l UTSW 5 118,859,539 (GRCm39) missense probably damaging 1.00
R6797:Med13l UTSW 5 118,897,329 (GRCm39) critical splice donor site probably null
R6911:Med13l UTSW 5 118,893,723 (GRCm39) missense possibly damaging 0.95
R6942:Med13l UTSW 5 118,883,071 (GRCm39) splice site probably null
R7018:Med13l UTSW 5 118,890,051 (GRCm39) missense probably damaging 0.99
R7096:Med13l UTSW 5 118,859,991 (GRCm39) missense possibly damaging 0.90
R7113:Med13l UTSW 5 118,864,330 (GRCm39) missense probably benign 0.09
R7136:Med13l UTSW 5 118,859,587 (GRCm39) missense possibly damaging 0.90
R7140:Med13l UTSW 5 118,880,037 (GRCm39) missense probably benign 0.27
R7345:Med13l UTSW 5 118,880,825 (GRCm39) missense probably damaging 1.00
R7409:Med13l UTSW 5 118,892,386 (GRCm39) missense probably benign 0.34
R7410:Med13l UTSW 5 118,698,897 (GRCm39) missense possibly damaging 0.94
R7432:Med13l UTSW 5 118,890,003 (GRCm39) missense probably damaging 0.99
R7486:Med13l UTSW 5 118,866,539 (GRCm39) missense probably benign 0.17
R7509:Med13l UTSW 5 118,886,995 (GRCm39) missense probably damaging 0.97
R7722:Med13l UTSW 5 118,885,472 (GRCm39) missense probably benign 0.32
R7802:Med13l UTSW 5 118,866,655 (GRCm39) missense probably benign 0.03
R8081:Med13l UTSW 5 118,866,333 (GRCm39) missense probably damaging 1.00
R8260:Med13l UTSW 5 118,886,794 (GRCm39) missense possibly damaging 0.95
R8266:Med13l UTSW 5 118,880,174 (GRCm39) missense probably damaging 1.00
R8365:Med13l UTSW 5 118,866,709 (GRCm39) missense possibly damaging 0.81
R8508:Med13l UTSW 5 118,892,386 (GRCm39) missense probably benign 0.34
R8920:Med13l UTSW 5 118,885,543 (GRCm39) nonsense probably null
R8970:Med13l UTSW 5 118,883,164 (GRCm39) missense probably damaging 1.00
R8994:Med13l UTSW 5 118,866,226 (GRCm39) missense possibly damaging 0.78
R9045:Med13l UTSW 5 118,880,816 (GRCm39) missense probably benign
R9401:Med13l UTSW 5 118,883,089 (GRCm39) missense probably benign 0.14
R9445:Med13l UTSW 5 118,862,214 (GRCm39) missense probably benign 0.00
R9446:Med13l UTSW 5 118,876,567 (GRCm39) missense probably benign 0.11
R9714:Med13l UTSW 5 118,866,438 (GRCm39) missense probably benign 0.44
R9777:Med13l UTSW 5 118,887,024 (GRCm39) missense probably benign
R9781:Med13l UTSW 5 118,868,032 (GRCm39) missense possibly damaging 0.60
R9797:Med13l UTSW 5 118,880,144 (GRCm39) missense probably damaging 1.00
X0065:Med13l UTSW 5 118,867,948 (GRCm39) missense probably damaging 1.00
Z1088:Med13l UTSW 5 118,887,706 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCTGACATCGGCCAAGCTG -3'
(R):5'- AGTCTGTACTCTGGGACACCTAC -3'

Sequencing Primer
(F):5'- CTGCAGAAAGACGCCTGATG -3'
(R):5'- GTACTCTGGGACACCTACCGTTG -3'
Posted On 2020-09-02