Incidental Mutation 'R8347:D6Wsu163e'
ID 645294
Institutional Source Beutler Lab
Gene Symbol D6Wsu163e
Ensembl Gene ENSMUSG00000030347
Gene Name DNA segment, Chr 6, Wayne State University 163, expressed
Synonyms
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 126916938-126952667 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 126932251 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 330 (L330*)
Ref Sequence ENSEMBL: ENSMUSP00000032497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032497]
AlphaFold Q91YN0
Predicted Effect probably null
Transcript: ENSMUST00000032497
AA Change: L330*
SMART Domains Protein: ENSMUSP00000032497
Gene: ENSMUSG00000030347
AA Change: L330*

DomainStartEndE-ValueType
Pfam:DUF2362 41 546 4.4e-218 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly conserved from nematodes to humans. In rat, the orthologous gene encodes a cytoplasmic protein that is involved in mast cell degranulation. The human gene has been implicated in autosomal recessive intellectual disability. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Irs2 C A 8: 11,058,000 (GRCm39) S144I possibly damaging Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in D6Wsu163e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:D6Wsu163e APN 6 126,921,815 (GRCm39) missense possibly damaging 0.89
IGL02019:D6Wsu163e APN 6 126,932,184 (GRCm39) missense probably damaging 1.00
IGL02890:D6Wsu163e APN 6 126,951,450 (GRCm39) missense probably damaging 1.00
IGL02954:D6Wsu163e APN 6 126,951,441 (GRCm39) splice site probably benign
IGL03179:D6Wsu163e APN 6 126,927,074 (GRCm39) missense probably damaging 1.00
R0267:D6Wsu163e UTSW 6 126,923,454 (GRCm39) missense probably benign 0.17
R1405:D6Wsu163e UTSW 6 126,951,446 (GRCm39) splice site probably benign
R1483:D6Wsu163e UTSW 6 126,931,733 (GRCm39) missense probably benign 0.03
R1636:D6Wsu163e UTSW 6 126,923,564 (GRCm39) missense possibly damaging 0.54
R1847:D6Wsu163e UTSW 6 126,932,112 (GRCm39) missense probably damaging 1.00
R5883:D6Wsu163e UTSW 6 126,943,879 (GRCm39) missense probably damaging 1.00
R7402:D6Wsu163e UTSW 6 126,938,968 (GRCm39) missense probably damaging 0.98
R7587:D6Wsu163e UTSW 6 126,932,859 (GRCm39) missense probably benign 0.00
R8229:D6Wsu163e UTSW 6 126,943,966 (GRCm39) missense probably benign 0.12
R8732:D6Wsu163e UTSW 6 126,932,859 (GRCm39) missense possibly damaging 0.72
R8903:D6Wsu163e UTSW 6 126,931,778 (GRCm39) missense probably damaging 1.00
R9206:D6Wsu163e UTSW 6 126,943,932 (GRCm39) missense probably benign 0.02
R9208:D6Wsu163e UTSW 6 126,943,932 (GRCm39) missense probably benign 0.02
R9333:D6Wsu163e UTSW 6 126,952,096 (GRCm39) missense probably damaging 0.99
R9747:D6Wsu163e UTSW 6 126,938,977 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGACGTTTGCATCCACTATAGG -3'
(R):5'- TAAGATCACTCAGCAGGCCC -3'

Sequencing Primer
(F):5'- GCATCCACTATAGGATTTCTGTAGC -3'
(R):5'- GTCTGTTACTCCACCACTTAGAAAG -3'
Posted On 2020-09-02