Incidental Mutation 'R8347:D6Wsu163e'
ID 645294
Institutional Source Beutler Lab
Gene Symbol D6Wsu163e
Ensembl Gene ENSMUSG00000030347
Gene Name DNA segment, Chr 6, Wayne State University 163, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 126939962-126975967 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 126955288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 330 (L330*)
Ref Sequence ENSEMBL: ENSMUSP00000032497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032497]
AlphaFold Q91YN0
Predicted Effect probably null
Transcript: ENSMUST00000032497
AA Change: L330*
SMART Domains Protein: ENSMUSP00000032497
Gene: ENSMUSG00000030347
AA Change: L330*

DomainStartEndE-ValueType
Pfam:DUF2362 41 546 4.4e-218 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly conserved from nematodes to humans. In rat, the orthologous gene encodes a cytoplasmic protein that is involved in mast cell degranulation. The human gene has been implicated in autosomal recessive intellectual disability. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr628 A G 7: 103,731,943 S6G probably benign Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in D6Wsu163e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:D6Wsu163e APN 6 126944852 missense possibly damaging 0.89
IGL02019:D6Wsu163e APN 6 126955221 missense probably damaging 1.00
IGL02890:D6Wsu163e APN 6 126974487 missense probably damaging 1.00
IGL02954:D6Wsu163e APN 6 126974478 splice site probably benign
IGL03179:D6Wsu163e APN 6 126950111 missense probably damaging 1.00
R0267:D6Wsu163e UTSW 6 126946491 missense probably benign 0.17
R1405:D6Wsu163e UTSW 6 126974483 splice site probably benign
R1483:D6Wsu163e UTSW 6 126954770 missense probably benign 0.03
R1636:D6Wsu163e UTSW 6 126946601 missense possibly damaging 0.54
R1847:D6Wsu163e UTSW 6 126955149 missense probably damaging 1.00
R5883:D6Wsu163e UTSW 6 126966916 missense probably damaging 1.00
R7402:D6Wsu163e UTSW 6 126962005 missense probably damaging 0.98
R7587:D6Wsu163e UTSW 6 126955896 missense probably benign 0.00
R8229:D6Wsu163e UTSW 6 126967003 missense probably benign 0.12
R8732:D6Wsu163e UTSW 6 126955896 missense possibly damaging 0.72
R8903:D6Wsu163e UTSW 6 126954815 missense probably damaging 1.00
R9206:D6Wsu163e UTSW 6 126966969 missense probably benign 0.02
R9208:D6Wsu163e UTSW 6 126966969 missense probably benign 0.02
R9333:D6Wsu163e UTSW 6 126975133 missense probably damaging 0.99
R9747:D6Wsu163e UTSW 6 126962014 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGACGTTTGCATCCACTATAGG -3'
(R):5'- TAAGATCACTCAGCAGGCCC -3'

Sequencing Primer
(F):5'- GCATCCACTATAGGATTTCTGTAGC -3'
(R):5'- GTCTGTTACTCCACCACTTAGAAAG -3'
Posted On 2020-09-02