Incidental Mutation 'R8347:Olfr628'
ID 645301
Institutional Source Beutler Lab
Gene Symbol Olfr628
Ensembl Gene ENSMUSG00000096516
Gene Name olfactory receptor 628
Synonyms GA_x6K02T2PBJ9-6457667-6458617, MOR22-4P, MOR22-4P, Olfr1526-ps1, MOR22-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103730374-103733324 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103731943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 6 (S6G)
Ref Sequence ENSEMBL: ENSMUSP00000095795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098193] [ENSMUST00000218266]
AlphaFold K7N6B2
Predicted Effect probably benign
Transcript: ENSMUST00000098193
AA Change: S6G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095795
Gene: ENSMUSG00000096516
AA Change: S6G

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 2.3e-106 PFAM
Pfam:7tm_1 43 295 1.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218266
AA Change: S6G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,236 D590V possibly damaging Het
1700123K08Rik T A 5: 138,562,891 I170L probably benign Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Ankib1 A G 5: 3,747,065 L249P probably damaging Het
Cabin1 A G 10: 75,742,367 F499L probably damaging Het
Clec12b C T 6: 129,380,487 probably null Het
Col23a1 G A 11: 51,571,256 G373D probably damaging Het
Cse1l C T 2: 166,927,585 T304I possibly damaging Het
D6Wsu163e T A 6: 126,955,288 L330* probably null Het
Dbi A C 1: 120,120,820 L32R possibly damaging Het
Dennd2c A G 3: 103,157,709 Y716C probably damaging Het
Dnah5 G A 15: 28,236,666 M379I possibly damaging Het
Dpys T C 15: 39,857,313 D17G probably benign Het
Dync2h1 C T 9: 7,116,578 S2319N possibly damaging Het
Dyrk2 T C 10: 118,859,983 K457E probably damaging Het
Efs A G 14: 54,919,784 C357R probably benign Het
Egfr T A 11: 16,878,174 W516R probably damaging Het
Folh1 T A 7: 86,729,118 R529* probably null Het
Fsip2 A C 2: 82,987,854 I4644L probably benign Het
Garnl3 T C 2: 33,085,891 Y66C probably damaging Het
Gli3 T C 13: 15,723,525 L730P probably damaging Het
Gm19668 T C 10: 77,798,387 *249W probably null Het
Gm28710 G A 5: 16,801,574 M96I probably benign Het
Ighv2-6-8 T C 12: 113,796,327 D54G probably benign Het
Irs2 C A 8: 11,008,000 S144I possibly damaging Het
Itgb5 T C 16: 33,940,678 C628R probably damaging Het
Kcnh4 A T 11: 100,757,749 V43D probably damaging Het
Krtap16-3 A T 16: 88,962,619 Y69N unknown Het
Lcn12 A C 2: 25,492,033 D176E possibly damaging Het
Lilr4b T A 10: 51,481,754 F181L probably damaging Het
Med13l T A 5: 118,742,597 H1251Q probably benign Het
Nppb C A 4: 147,986,299 L44M probably damaging Het
Nutm2 T C 13: 50,472,337 V320A probably benign Het
Olfr1272 A T 2: 90,281,676 W300R probably benign Het
Olfr291 C T 7: 84,856,755 P131S probably damaging Het
Olfr987 T A 2: 85,331,703 H65L probably damaging Het
Padi6 T C 4: 140,735,408 M301V probably benign Het
Pappa G A 4: 65,327,065 R1530Q probably damaging Het
Pcgf6 C T 19: 47,045,838 D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,390,749 probably benign Het
Phip A G 9: 82,908,763 I710T probably benign Het
Pla2r1 A T 2: 60,534,903 Y108N probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Rint1 C G 5: 23,811,772 L512V probably damaging Het
Sdad1 A C 5: 92,298,229 F282L probably benign Het
Sirt5 G T 13: 43,380,501 A189S probably benign Het
Slc14a1 T C 18: 78,111,431 T247A probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slfn3 A G 11: 83,213,589 K429E possibly damaging Het
Spag17 T C 3: 100,027,641 F721S probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Sult2a6 A G 7: 14,225,958 Y217H probably benign Het
Synj2 A G 17: 6,009,785 N394S probably damaging Het
Telo2 A T 17: 25,104,637 Y605* probably null Het
Trank1 T A 9: 111,367,249 L1447Q probably damaging Het
Trim56 A G 5: 137,112,592 L690P probably damaging Het
Trmt13 T C 3: 116,582,768 T325A probably benign Het
Ttn T A 2: 76,709,467 T34392S probably benign Het
Uncx A G 5: 139,546,816 E212G probably damaging Het
Ush2a A G 1: 188,947,084 T4830A probably benign Het
Usp34 C A 11: 23,412,345 T1616N Het
Vars C T 17: 35,015,977 L1261F possibly damaging Het
Vmn1r223 T C 13: 23,249,850 S205P probably damaging Het
Vmn2r118 A T 17: 55,610,423 I363K possibly damaging Het
Vmn2r69 A T 7: 85,415,630 M16K probably benign Het
Wdr62 G A 7: 30,262,703 T428I possibly damaging Het
Yeats4 A T 10: 117,217,469 L129Q probably benign Het
Zfp423 T C 8: 87,783,156 R187G probably damaging Het
Zfp853 A T 5: 143,288,947 L321Q unknown Het
Other mutations in Olfr628
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Olfr628 APN 7 103732480 missense possibly damaging 0.47
IGL02121:Olfr628 APN 7 103732469 missense probably damaging 1.00
R0140:Olfr628 UTSW 7 103732142 missense probably damaging 1.00
R0505:Olfr628 UTSW 7 103732376 missense probably benign 0.09
R0582:Olfr628 UTSW 7 103732673 missense possibly damaging 0.82
R1585:Olfr628 UTSW 7 103732378 missense possibly damaging 0.56
R1907:Olfr628 UTSW 7 103731983 missense probably damaging 1.00
R4766:Olfr628 UTSW 7 103732250 missense possibly damaging 0.70
R4954:Olfr628 UTSW 7 103732207 missense probably damaging 1.00
R5464:Olfr628 UTSW 7 103732189 missense probably damaging 1.00
R6737:Olfr628 UTSW 7 103732150 missense probably damaging 1.00
R6761:Olfr628 UTSW 7 103732484 missense probably damaging 1.00
R6782:Olfr628 UTSW 7 103732342 missense possibly damaging 0.67
R7015:Olfr628 UTSW 7 103732817 missense probably null 0.85
R7503:Olfr628 UTSW 7 103732267 missense probably damaging 1.00
R7959:Olfr628 UTSW 7 103732808 missense probably damaging 1.00
R8984:Olfr628 UTSW 7 103732013 missense probably damaging 0.99
R9000:Olfr628 UTSW 7 103732465 missense probably damaging 0.99
R9204:Olfr628 UTSW 7 103732849 missense possibly damaging 0.72
X0058:Olfr628 UTSW 7 103732282 missense probably damaging 1.00
Z1176:Olfr628 UTSW 7 103732781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTGTGATGAGATAGACATGC -3'
(R):5'- CTAGAAAGAGGTACATGGGCTC -3'

Sequencing Primer
(F):5'- TTCACACCTAGAGAAGATATGTAGAC -3'
(R):5'- TCATGGAGGCTTCGCTCAAC -3'
Posted On 2020-09-02