Incidental Mutation 'R8347:Irs2'
ID 645302
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Name insulin receptor substrate 2
Synonyms Irs-2
MMRRC Submission 067867-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.579) question?
Stock # R8347 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 11034681-11058458 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 11058000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 144 (S144I)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
AlphaFold P81122
PDB Structure Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040514
AA Change: S144I

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: S144I

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T A 5: 138,561,153 (GRCm39) I170L probably benign Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Ankib1 A G 5: 3,797,065 (GRCm39) L249P probably damaging Het
Cabin1 A G 10: 75,578,201 (GRCm39) F499L probably damaging Het
Cdhr17 G A 5: 17,006,572 (GRCm39) M96I probably benign Het
Clec12b C T 6: 129,357,450 (GRCm39) probably null Het
Col23a1 G A 11: 51,462,083 (GRCm39) G373D probably damaging Het
Cse1l C T 2: 166,769,505 (GRCm39) T304I possibly damaging Het
D6Wsu163e T A 6: 126,932,251 (GRCm39) L330* probably null Het
Dbi A C 1: 120,048,550 (GRCm39) L32R possibly damaging Het
Dennd2c A G 3: 103,065,025 (GRCm39) Y716C probably damaging Het
Dnah5 G A 15: 28,236,812 (GRCm39) M379I possibly damaging Het
Dpys T C 15: 39,720,709 (GRCm39) D17G probably benign Het
Dync2h1 C T 9: 7,116,578 (GRCm39) S2319N possibly damaging Het
Dyrk2 T C 10: 118,695,888 (GRCm39) K457E probably damaging Het
Efs A G 14: 55,157,241 (GRCm39) C357R probably benign Het
Egfr T A 11: 16,828,174 (GRCm39) W516R probably damaging Het
Folh1 T A 7: 86,378,326 (GRCm39) R529* probably null Het
Fsip2 A C 2: 82,818,198 (GRCm39) I4644L probably benign Het
Garnl3 T C 2: 32,975,903 (GRCm39) Y66C probably damaging Het
Gli3 T C 13: 15,898,110 (GRCm39) L730P probably damaging Het
Gm19668 T C 10: 77,634,221 (GRCm39) *249W probably null Het
Ighv2-6-8 T C 12: 113,759,947 (GRCm39) D54G probably benign Het
Itgb5 T C 16: 33,761,048 (GRCm39) C628R probably damaging Het
Kcnh4 A T 11: 100,648,575 (GRCm39) V43D probably damaging Het
Krtap16-3 A T 16: 88,759,507 (GRCm39) Y69N unknown Het
Lcn12 A C 2: 25,382,045 (GRCm39) D176E possibly damaging Het
Lilrb4b T A 10: 51,357,850 (GRCm39) F181L probably damaging Het
Med13l T A 5: 118,880,662 (GRCm39) H1251Q probably benign Het
Nppb C A 4: 148,070,756 (GRCm39) L44M probably damaging Het
Nutm2 T C 13: 50,626,373 (GRCm39) V320A probably benign Het
Or4b1b A T 2: 90,112,020 (GRCm39) W300R probably benign Het
Or52a24 A G 7: 103,381,150 (GRCm39) S6G probably benign Het
Or5ae2 C T 7: 84,505,963 (GRCm39) P131S probably damaging Het
Or5ak4 T A 2: 85,162,047 (GRCm39) H65L probably damaging Het
Padi6 T C 4: 140,462,719 (GRCm39) M301V probably benign Het
Pappa G A 4: 65,245,302 (GRCm39) R1530Q probably damaging Het
Pcgf6 C T 19: 47,034,277 (GRCm39) D255N possibly damaging Het
Pgap3 TCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAG 11: 98,281,575 (GRCm39) probably benign Het
Phip A G 9: 82,790,816 (GRCm39) I710T probably benign Het
Pla2r1 A T 2: 60,365,247 (GRCm39) Y108N probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Rint1 C G 5: 24,016,770 (GRCm39) L512V probably damaging Het
Sdad1 A C 5: 92,446,088 (GRCm39) F282L probably benign Het
Sirt5 G T 13: 43,533,977 (GRCm39) A189S probably benign Het
Slc14a1 T C 18: 78,154,646 (GRCm39) T247A probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slfn3 A G 11: 83,104,415 (GRCm39) K429E possibly damaging Het
Spag17 T C 3: 99,934,957 (GRCm39) F721S probably benign Het
Spata31d1e T A 13: 59,890,050 (GRCm39) D590V possibly damaging Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Sult2a6 A G 7: 13,959,883 (GRCm39) Y217H probably benign Het
Synj2 A G 17: 6,060,060 (GRCm39) N394S probably damaging Het
Telo2 A T 17: 25,323,611 (GRCm39) Y605* probably null Het
Trank1 T A 9: 111,196,317 (GRCm39) L1447Q probably damaging Het
Trim56 A G 5: 137,141,446 (GRCm39) L690P probably damaging Het
Trmt13 T C 3: 116,376,417 (GRCm39) T325A probably benign Het
Ttn T A 2: 76,539,811 (GRCm39) T34392S probably benign Het
Uncx A G 5: 139,532,571 (GRCm39) E212G probably damaging Het
Ush2a A G 1: 188,679,281 (GRCm39) T4830A probably benign Het
Usp34 C A 11: 23,362,345 (GRCm39) T1616N Het
Vars1 C T 17: 35,234,953 (GRCm39) L1261F possibly damaging Het
Vmn1r223 T C 13: 23,434,020 (GRCm39) S205P probably damaging Het
Vmn2r118 A T 17: 55,917,423 (GRCm39) I363K possibly damaging Het
Vmn2r69 A T 7: 85,064,838 (GRCm39) M16K probably benign Het
Wdr62 G A 7: 29,962,128 (GRCm39) T428I possibly damaging Het
Yeats4 A T 10: 117,053,374 (GRCm39) L129Q probably benign Het
Zfp423 T C 8: 88,509,784 (GRCm39) R187G probably damaging Het
Zfp853 A T 5: 143,274,702 (GRCm39) L321Q unknown Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11,055,867 (GRCm39) missense probably benign 0.00
IGL01328:Irs2 APN 8 11,054,792 (GRCm39) missense probably damaging 0.99
IGL01875:Irs2 APN 8 11,056,221 (GRCm39) missense probably damaging 0.98
IGL02444:Irs2 APN 8 11,056,306 (GRCm39) missense probably benign 0.03
IGL02448:Irs2 APN 8 11,057,862 (GRCm39) missense probably benign 0.21
IGL02945:Irs2 APN 8 11,057,781 (GRCm39) missense probably damaging 1.00
IGL03068:Irs2 APN 8 11,054,974 (GRCm39) missense probably damaging 0.99
beefed UTSW 8 11,056,522 (GRCm39) nonsense probably null
Dum_dum UTSW 8 11,037,012 (GRCm39) makesense probably null
Lush UTSW 8 11,056,678 (GRCm39) nonsense probably null
muscular UTSW 8 11,054,659 (GRCm39) nonsense probably null
Plink UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11,055,723 (GRCm39) missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11,054,691 (GRCm39) missense probably damaging 1.00
R0147:Irs2 UTSW 8 11,057,568 (GRCm39) missense probably damaging 1.00
R0501:Irs2 UTSW 8 11,056,396 (GRCm39) missense probably damaging 1.00
R0565:Irs2 UTSW 8 11,054,592 (GRCm39) missense probably damaging 0.98
R2042:Irs2 UTSW 8 11,057,580 (GRCm39) missense probably damaging 0.99
R2268:Irs2 UTSW 8 11,057,586 (GRCm39) missense probably damaging 0.98
R2518:Irs2 UTSW 8 11,055,352 (GRCm39) missense probably benign 0.00
R2762:Irs2 UTSW 8 11,056,408 (GRCm39) missense probably damaging 1.00
R3623:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R3624:Irs2 UTSW 8 11,057,643 (GRCm39) missense probably damaging 1.00
R5022:Irs2 UTSW 8 11,037,012 (GRCm39) makesense probably null
R5270:Irs2 UTSW 8 11,056,678 (GRCm39) nonsense probably null
R5377:Irs2 UTSW 8 11,055,277 (GRCm39) missense probably benign 0.00
R5604:Irs2 UTSW 8 11,055,007 (GRCm39) missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11,056,805 (GRCm39) missense probably benign 0.01
R6219:Irs2 UTSW 8 11,055,121 (GRCm39) missense probably damaging 0.99
R6654:Irs2 UTSW 8 11,056,486 (GRCm39) missense probably damaging 1.00
R6726:Irs2 UTSW 8 11,054,961 (GRCm39) missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11,054,659 (GRCm39) nonsense probably null
R6934:Irs2 UTSW 8 11,054,697 (GRCm39) missense probably damaging 0.99
R7261:Irs2 UTSW 8 11,057,018 (GRCm39) missense possibly damaging 0.95
R7285:Irs2 UTSW 8 11,056,797 (GRCm39) missense probably damaging 0.99
R7458:Irs2 UTSW 8 11,057,739 (GRCm39) missense probably damaging 0.99
R7757:Irs2 UTSW 8 11,056,522 (GRCm39) nonsense probably null
R8348:Irs2 UTSW 8 11,054,974 (GRCm39) missense probably damaging 0.98
R8377:Irs2 UTSW 8 11,054,848 (GRCm39) nonsense probably null
R8444:Irs2 UTSW 8 11,056,683 (GRCm39) missense probably damaging 0.99
R8912:Irs2 UTSW 8 11,056,655 (GRCm39) missense probably damaging 0.96
R9229:Irs2 UTSW 8 11,057,400 (GRCm39) missense probably damaging 1.00
R9344:Irs2 UTSW 8 11,057,289 (GRCm39) nonsense probably null
R9405:Irs2 UTSW 8 11,055,061 (GRCm39) missense possibly damaging 0.95
R9484:Irs2 UTSW 8 11,057,334 (GRCm39) missense probably damaging 0.99
R9736:Irs2 UTSW 8 11,058,217 (GRCm39) missense probably damaging 1.00
Z1176:Irs2 UTSW 8 11,056,185 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCCCAGTCCCTTAGGTTTC -3'
(R):5'- GCTGGAGTACTACGAGAGCG -3'

Sequencing Primer
(F):5'- AGTCCCTTAGGTTTCAGGTTCAC -3'
(R):5'- CTGGAGTACTACGAGAGCGAGAAG -3'
Posted On 2020-09-02