Mutagenetix > Incidental Mutation

Incidental Mutation 'R8347:Irs2'

645302

Institutional Source

Beutler Lab

Gene Symbol

Irs2

Ensembl Gene

ENSMUSG00000038894

Gene Name

insulin receptor substrate 2

Synonyms

Irs-2

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.700) question?

Stock #

R8347 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10984681-11008458 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 11008000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Isoleucine at position 144 (S144I)

Ref Sequence

ENSEMBL: ENSMUSP00000038514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040514]

AlphaFold

P81122

PDB Structure

Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040514
AA Change: S144I

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: S144I

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	19	28	N/A	INTRINSIC
PH	31	146	2.83e-13	SMART
IRS	191	293	4.98e-38	SMART
PTBI	191	293	2.24e-51	SMART
low complexity region	301	309	N/A	INTRINSIC
low complexity region	364	377	N/A	INTRINSIC
low complexity region	435	473	N/A	INTRINSIC
low complexity region	478	490	N/A	INTRINSIC
low complexity region	688	710	N/A	INTRINSIC
low complexity region	721	730	N/A	INTRINSIC
low complexity region	834	846	N/A	INTRINSIC
low complexity region	923	959	N/A	INTRINSIC
low complexity region	976	984	N/A	INTRINSIC
low complexity region	997	1028	N/A	INTRINSIC
low complexity region	1137	1154	N/A	INTRINSIC
low complexity region	1191	1208	N/A	INTRINSIC
low complexity region	1274	1296	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	A	13: 59,742,236	D590V	possibly damaging	Het
1700123K08Rik	T	A	5: 138,562,891	I170L	probably benign	Het
Adamts15	C	T	9: 30,902,550	R773Q	probably benign	Het
Ankib1	A	G	5: 3,747,065	L249P	probably damaging	Het
Cabin1	A	G	10: 75,742,367	F499L	probably damaging	Het
Clec12b	C	T	6: 129,380,487		probably null	Het
Col23a1	G	A	11: 51,571,256	G373D	probably damaging	Het
Cse1l	C	T	2: 166,927,585	T304I	possibly damaging	Het
D6Wsu163e	T	A	6: 126,955,288	L330*	probably null	Het
Dbi	A	C	1: 120,120,820	L32R	possibly damaging	Het
Dennd2c	A	G	3: 103,157,709	Y716C	probably damaging	Het
Dnah5	G	A	15: 28,236,666	M379I	possibly damaging	Het
Dpys	T	C	15: 39,857,313	D17G	probably benign	Het
Dync2h1	C	T	9: 7,116,578	S2319N	possibly damaging	Het
Dyrk2	T	C	10: 118,859,983	K457E	probably damaging	Het
Efs	A	G	14: 54,919,784	C357R	probably benign	Het
Egfr	T	A	11: 16,878,174	W516R	probably damaging	Het
Folh1	T	A	7: 86,729,118	R529*	probably null	Het
Fsip2	A	C	2: 82,987,854	I4644L	probably benign	Het
Garnl3	T	C	2: 33,085,891	Y66C	probably damaging	Het
Gli3	T	C	13: 15,723,525	L730P	probably damaging	Het
Gm19668	T	C	10: 77,798,387	*249W	probably null	Het
Gm28710	G	A	5: 16,801,574	M96I	probably benign	Het
Ighv2-6-8	T	C	12: 113,796,327	D54G	probably benign	Het
Itgb5	T	C	16: 33,940,678	C628R	probably damaging	Het
Kcnh4	A	T	11: 100,757,749	V43D	probably damaging	Het
Krtap16-3	A	T	16: 88,962,619	Y69N	unknown	Het
Lcn12	A	C	2: 25,492,033	D176E	possibly damaging	Het
Lilr4b	T	A	10: 51,481,754	F181L	probably damaging	Het
Med13l	T	A	5: 118,742,597	H1251Q	probably benign	Het
Nppb	C	A	4: 147,986,299	L44M	probably damaging	Het
Nutm2	T	C	13: 50,472,337	V320A	probably benign	Het
Olfr1272	A	T	2: 90,281,676	W300R	probably benign	Het
Olfr291	C	T	7: 84,856,755	P131S	probably damaging	Het
Olfr628	A	G	7: 103,731,943	S6G	probably benign	Het
Olfr987	T	A	2: 85,331,703	H65L	probably damaging	Het
Padi6	T	C	4: 140,735,408	M301V	probably benign	Het
Pappa	G	A	4: 65,327,065	R1530Q	probably damaging	Het
Pcgf6	C	T	19: 47,045,838	D255N	possibly damaging	Het
Pgap3	TCAGCAGCAGCAGCAGCAG	TCAGCAGCAGCAGCAG	11: 98,390,749		probably benign	Het
Phip	A	G	9: 82,908,763	I710T	probably benign	Het
Pla2r1	A	T	2: 60,534,903	Y108N	probably damaging	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Rint1	C	G	5: 23,811,772	L512V	probably damaging	Het
Sdad1	A	C	5: 92,298,229	F282L	probably benign	Het
Sirt5	G	T	13: 43,380,501	A189S	probably benign	Het
Slc14a1	T	C	18: 78,111,431	T247A	probably benign	Het
Slc22a6	C	G	19: 8,621,805	R267G	probably damaging	Het
Slfn3	A	G	11: 83,213,589	K429E	possibly damaging	Het
Spag17	T	C	3: 100,027,641	F721S	probably benign	Het
St3gal1	G	A	15: 67,113,662	R48C	probably damaging	Het
Sult2a6	A	G	7: 14,225,958	Y217H	probably benign	Het
Synj2	A	G	17: 6,009,785	N394S	probably damaging	Het
Telo2	A	T	17: 25,104,637	Y605*	probably null	Het
Trank1	T	A	9: 111,367,249	L1447Q	probably damaging	Het
Trim56	A	G	5: 137,112,592	L690P	probably damaging	Het
Trmt13	T	C	3: 116,582,768	T325A	probably benign	Het
Ttn	T	A	2: 76,709,467	T34392S	probably benign	Het
Uncx	A	G	5: 139,546,816	E212G	probably damaging	Het
Ush2a	A	G	1: 188,947,084	T4830A	probably benign	Het
Usp34	C	A	11: 23,412,345	T1616N		Het
Vars	C	T	17: 35,015,977	L1261F	possibly damaging	Het
Vmn1r223	T	C	13: 23,249,850	S205P	probably damaging	Het
Vmn2r118	A	T	17: 55,610,423	I363K	possibly damaging	Het
Vmn2r69	A	T	7: 85,415,630	M16K	probably benign	Het
Wdr62	G	A	7: 30,262,703	T428I	possibly damaging	Het
Yeats4	A	T	10: 117,217,469	L129Q	probably benign	Het
Zfp423	T	C	8: 87,783,156	R187G	probably damaging	Het
Zfp853	A	T	5: 143,288,947	L321Q	unknown	Het

Other mutations in Irs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Irs2	APN	8	11005867	missense	probably benign	0.00
IGL01328:Irs2	APN	8	11004792	missense	probably damaging	0.99
IGL01875:Irs2	APN	8	11006221	missense	probably damaging	0.98
IGL02444:Irs2	APN	8	11006306	missense	probably benign	0.03
IGL02448:Irs2	APN	8	11007862	missense	probably benign	0.21
IGL02945:Irs2	APN	8	11007781	missense	probably damaging	1.00
IGL03068:Irs2	APN	8	11004974	missense	probably damaging	0.99
beefed	UTSW	8	11006522	nonsense	probably null
Dum_dum	UTSW	8	10987012	makesense	probably null
Lush	UTSW	8	11006678	nonsense	probably null
muscular	UTSW	8	11004659	nonsense	probably null
Plink	UTSW	8	11005121	missense	probably damaging	0.99
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0062:Irs2	UTSW	8	11005723	missense	possibly damaging	0.65
R0107:Irs2	UTSW	8	11004691	missense	probably damaging	1.00
R0147:Irs2	UTSW	8	11007568	missense	probably damaging	1.00
R0501:Irs2	UTSW	8	11006396	missense	probably damaging	1.00
R0565:Irs2	UTSW	8	11004592	missense	probably damaging	0.98
R2042:Irs2	UTSW	8	11007580	missense	probably damaging	0.99
R2268:Irs2	UTSW	8	11007586	missense	probably damaging	0.98
R2518:Irs2	UTSW	8	11005352	missense	probably benign	0.00
R2762:Irs2	UTSW	8	11006408	missense	probably damaging	1.00
R3623:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R3624:Irs2	UTSW	8	11007643	missense	probably damaging	1.00
R5022:Irs2	UTSW	8	10987012	makesense	probably null
R5270:Irs2	UTSW	8	11006678	nonsense	probably null
R5377:Irs2	UTSW	8	11005277	missense	probably benign	0.00
R5604:Irs2	UTSW	8	11005007	missense	possibly damaging	0.84
R6049:Irs2	UTSW	8	11006805	missense	probably benign	0.01
R6219:Irs2	UTSW	8	11005121	missense	probably damaging	0.99
R6654:Irs2	UTSW	8	11006486	missense	probably damaging	1.00
R6726:Irs2	UTSW	8	11004961	missense	possibly damaging	0.86
R6813:Irs2	UTSW	8	11004659	nonsense	probably null
R6934:Irs2	UTSW	8	11004697	missense	probably damaging	0.99
R7261:Irs2	UTSW	8	11007018	missense	possibly damaging	0.95
R7285:Irs2	UTSW	8	11006797	missense	probably damaging	0.99
R7458:Irs2	UTSW	8	11007739	missense	probably damaging	0.99
R7757:Irs2	UTSW	8	11006522	nonsense	probably null
R8348:Irs2	UTSW	8	11004974	missense	probably damaging	0.98
R8377:Irs2	UTSW	8	11004848	nonsense	probably null
R8444:Irs2	UTSW	8	11006683	missense	probably damaging	0.99
R8912:Irs2	UTSW	8	11006655	missense	probably damaging	0.96
R9229:Irs2	UTSW	8	11007400	missense	probably damaging	1.00
R9344:Irs2	UTSW	8	11007289	nonsense	probably null
R9405:Irs2	UTSW	8	11005061	missense	possibly damaging	0.95
R9484:Irs2	UTSW	8	11007334	missense	probably damaging	0.99
R9736:Irs2	UTSW	8	11008217	missense	probably damaging	1.00
Z1176:Irs2	UTSW	8	11006185	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGCCCAGTCCCTTAGGTTTC -3'
(R):5'- GCTGGAGTACTACGAGAGCG -3'

Sequencing Primer
(F):5'- AGTCCCTTAGGTTTCAGGTTCAC -3'
(R):5'- CTGGAGTACTACGAGAGCGAGAAG -3'

Posted On

2020-09-02